‚T‚æ‚į‚ń‚Ė‚é šƒXƒ}ƒz”Łš ”ŒfŽ¦”Ā‚ɖ߂達 ‘S•” 1- ÅV50  

awk‚É‚Ā‚¢‚ÄŒź‚éƒXƒŒ $2

1 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/02/23(‹ą) 23:55:42
•…‚Į‚Ä‚ą‘āH éuūū‚ą˜V‚¢‚Ä‚Ķém”n‚É—ņ‚éH
ŽOl‚Ģ×Šw‚Ŗ¶‚Żo‚µ‚½ƒXƒNƒŠƒvƒgŒ¾ŒźAWK‚É‚Ā‚¢‚ÄŒź‚éƒXƒŒ

Ÿ ‘OƒXƒŒ
awk‚É‚Ā‚¢‚ÄŒź‚éƒXƒŒ
http://pc10.2ch.net/test/read.cgi/tech/1023556171/

Ÿ ŠÖŒWƒXƒŒ
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‘Š’kŽŗ
http://pc10.2ch.net/test/read.cgi/tech/1112553783/
AWK‚ÅCGI
http://pc10.2ch.net/test/read.cgi/php/1171804314/
ysedzƒVƒFƒ‹ƒXƒNƒŠƒvƒg‘‡@LINUX Part2yawkz
http://pc10.2ch.net/test/read.cgi/linux/1154578200/

Ÿ ŽQl
The AWK Programming Language (Brian Kernighan)F
ttp://cm.bell-labs.com/cm/cs/awkbook/index.html

GAWK (GNU Projedt):
ttp://www.gnu.org/software/gawk/

2 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/02/24(“y) 00:04:13
awking shoes

3 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/02/24(“y) 00:24:49
ƒI[ƒN
ƒI[ƒN
ƒI[ƒN

@‰œ‚³‚ń

4 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/02/24(“y) 01:35:13
‘½‚­‚ĶŒź‚é‚Ü‚¢B

Mawk - Mike' AWK
http://gnuwin32.sourceforge.net/packages/mawk.htm

5 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/02/24(“y) 23:32:05
‚¢‚ā‘½‚­‚šŒź‚Į‚Ä‚­‚ź

6 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/02/25(“ś) 06:34:37
ƒ[ƒJƒ‹•Ļ”AB

7 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/02/27(‰Ī) 21:39:18
ƒNƒ[ƒWƒƒ‚šŽ‚Į‚½awkŽĄ‘•‚Ę‚©‚Č‚¢‚©‚Ė

8 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/02/27(‰Ī) 23:45:59
ƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒg‚Å‚æ‚å‚æ‚å‚Į‚ĘŽg‚¤‚±‚Ę‚Ķ•p”É‚É‚ ‚é‚Æ‚Ē
‹C‡‚¢“ü‚ź‚ăvƒƒOƒ‰ƒ~ƒ“ƒO‚·‚é‚Į‚Ä‚Ģ‚ĶÅ‹ß–³‚­‚Č‚Į‚½B

9 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/02/28(…) 00:13:16
>>7
‘OƒXƒŒ‚ÉObjective awk‚ŖŽĄŻ‚·‚é‚©‚Ģ‚ꂤ‚Č˜b‚Ŗ‚ ‚é‚Ŗƒlƒ^‚¾‚ė‚¤B
ŽĄ—p«‚š–³Ž‹‚·‚ź‚ĪawkŽ©g‚ŏ‘‚­‚±‚Ę‚ą•s‰Ā”\‚Å‚Ķ‚Č‚¢‚©‚ą‚µ‚ź‚Č‚¢B
‚Ø–]‚Ż‚Ɉź”Ō‹ß‚¢ŽĄ‘•‚ĶAŽĄ‚ĶJavaScript‚Å‚Ķ‚Č‚¢‚©‚ʁB
http://developer.mozilla.org/ja/docs/New_in_JavaScript_1.7

10 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/03/01(–Ų) 00:43:46
ƒgƒbƒpƒ“‚ĢƒvƒƒOƒ‰ƒ~ƒ“ƒOŒ¾ŒźAWK‚ŖƒuƒbƒNƒIƒt‚Å105‰~‚Å’@‚«”„‚ē‚ź‚Ä‚é‚Ģ‚šŒ©‚Ä
‚Č‚ń‚©”ß‚µ‚¢‹C•Ŗ‚É‚Č‚Į‚½

11 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/03/01(–Ų) 16:01:47
>>10
‰“‚ąƒIƒ‰ƒCƒŠ[‚Ģused & awk ƒvƒƒOƒ‰ƒ~ƒ“ƒOv–{‚ŖA}‘ŠŁ‚Ģu–³—æ‚ÅŽ‚Į‚ĂƁ[’Iv
‚É‚ ‚Į‚½‚Ģ‚ŁA‘¦ GET ‚µ‚½B‚Ü‚ A‚©‚Č‚čŒĆ‚¢–{i1991 ”Nj‚¾‚Æ‚ĒA“ą—e‚Ķ‚¢‚¢–{‚¾B
’č‰æ \3800 ‰~‚ĢƒoƒJ‚–{‚ŁA ‚½‚Ō‚ńAV‘‚Å‚Ķ”ƒ‚ķ‚Č‚©‚Į‚½‚¾‚ė‚¤B

ƒgƒbƒpƒ“‚ĢƒvƒƒOƒ‰ƒ~ƒ“ƒOŒ¾ŒźAWK‚Į‚āA‚¢‚Ā‚²‚ė‚Ģ–{‚¾‚Į‚½‚ƁB‚Ę‚č‚ ‚¦‚øA105‰~‚Č‚ē
—~‚µ‚¢‚Į‚·B

12 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/03/01(–Ų) 21:49:42
>>11
Ō‚¢•\Ž†‚Ģ‘ę‚P”Å‚¾‚Ė‚«‚Į‚ʁB
—Ī‚Ģ•\Ž†‚Ģ‘ę‚Q”Å‚ŖŽčŒ³‚É‚ ‚é‚Æ‚ĒAgawk‚ÅŠg’£‚³‚ź‚Ä‚¢‚é
³‹K•\Œ»‚Ģą–¾‚Ę‚©‘‚¦‚Ä‚Ä‘ę‚Q”Å‚Ģ‚Ł‚¤‚Ŗ‚ØŠ©‚߁B
‚æ‚Č‚Ż‚É’č‰æ‚S‚P‚O‚O‰~‚Č‚čB

13 F11F2007/03/01(–Ų) 23:52:54
>>12
> Ō‚¢•\Ž†‚Ģ‘ę‚P”Å‚¾‚Ė‚«‚Į‚ʁB
‚»‚¤A‚»‚ź‚»‚źB ‚Ł‚ń‚ŁA
gensub ‚Ŗ‚Č‚¢B‚ą‚æ‚ė‚ńA
/inet/..... |& ....@‚ą‚Č‚¢B

Å‹ßA/inet/..... |& ....@‚Ŗ‚ ‚éigawk3.1 ‚©‚ēj‚±‚Ę‚š’m‚Į‚āAgawk ‚šŒ©’¼‚µ‚Ä‚¢‚éB
Žg‚¢ŽĢ‚Ä‚ĢƒvƒƒOƒ‰ƒ€‚Ķ gawk ‚ɏ`!!B


14 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/03/02(‹ą) 02:09:03
>>11
ƒgƒbƒpƒ“‚ĢÅ‰‚Ģ–{‚Č‚ēŠm‚©1990”N‚Ģt ‚¾‚Į‚½‚ĘŽv‚¤B
ˆź‰žnawkƒŒƒxƒ‹‚Ģ‹Lq‚Ģ‚Ķ‚ø‚Č‚ń‚ŁAgawk‚Č‚ń‚©‚ĢŒÅ—L‚Ģ
Šg’£‚šœ‚Æ‚Ī\•ŖŽg‚¦‚é‚Å‚µ‚åB

105‰~‚Ķc‚æ‚ʔ߂µ‚¢‚Æ‚Ē‚¢‚¢l‚ɏE‚ķ‚ź‚Ä—~‚µ‚¢‚Ė‚¦B


15 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/03/02(‹ą) 02:27:22
>>13
gawk‚Ģ /inet Šg’£‚Į‚ăCƒ}ƒCƒ`Žg‚¢‚Ć‚ē‚­‚Ė?

”Ä—p“I‚Č‚Ģ‚©‚ą‚µ‚ź‚Č‚¢‚Æ‚ĒA‚ØŽčŒy‚ÉhttpŒo—R‚Åwebƒy[ƒW‚Ģ
“ą—eŽę‚ź‚ź‚Ī‚¢‚¢‚Į‚Ä‚Ę‚«‚É‹Lq‚Ŗ–Ź“|B


16 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/03/04(“ś) 00:06:22
>>15
’Pƒ‚É

gawk '{print $0}' http://foo.org/index.html

‚Ę‚©‚ŃV[ƒ€ƒŒƒX‚ɃAƒNƒZƒX‚Å‚«‚é‚Ę‚¢‚¤‚Ł‚¤‚Ŗ•Ö—˜‚Č‚Ģ‚©‚Č?

17 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/03/04(“ś) 00:24:42
http://www.gnu.org/software/gawk/manual/gawkinet/gawkinet.html#Web-page
‚©‚ēAŠČ’P‚Č—įB

BEGIN {
RS = ORS = "\r\n"
HttpService = "/inet/tcp/0/www.yahoo.com/80"
print "GET http://www.yahoo.com" |& HttpService
while ((HttpService |& getline) > 0)
print $0
close(HttpService)
}


18 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/03/04(“ś) 00:38:54
awk‚ÅSQL‚Ģleftjoin‚Ż‚½‚¢‚Č‚±‚Ę‚Å‚«‚éH

19 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/03/04(“ś) 01:55:43
>>17
‚Č‚ń‚¶‚į‚±‚č‚įB
wget -O - http://www.yahoo.com/ ‚Ģo—Ķ‚š“Ē‚Ž‚Ģ‚Ę‘S‘R•Ļ‚ķ‚ē‚ń‚ȁB

20 F15F2007/03/04(“ś) 03:46:24
>>16
‚Ü‚  wget‚Ę‚©curlŽg‚Į‚Ä•W€“ü—Ķ‚©‚ēŽę‚ź‚ę‚Ę‚¢‚¤˜b‚ą‚ ‚é‚©‚ą‚µ‚ź‚Č‚¢‚Æ‚ĒA
http://‚Ł‚°‚Ł‚° ‚Ķ“Į•Źˆµ‚¢‚µ‚Ä‚­‚ź‚é‚Ę‚¤‚ź‚µ‚¢‚Č‚ ‚ĘŽv‚Į‚Ä‚éB

‚Ü‚ HTML“Ē‚ń‚Å‚»‚ź‚š‰šĶ‚·‚éŽčŠŌ‚ŖŽŸ‚É‘Ņ‚Į‚Ä‚é‚Æ‚Ē‚³w


21 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/03/04(“ś) 03:55:11
ƒGƒ“ƒR[ƒfƒBƒ“ƒO‘Ī‰ž‚Ę‚©FXl‚¦‚é‚ʁAawk‚ÅHTML‚šˆ—‚µ‚ꂤ‚Ę‚·‚é‚Ł‚¤‚Ŗ
–³—‚Ŗ‚ ‚銓‚¶B
‘f’¼‚ÉP‚Å‚Ķ‚¶‚܂錾Œź‚Ę‚©Žg‚Į‚Ę‚Æ‚ĪH‚Ż‚½‚¢‚ȁB

22 F19F2007/03/04(“ś) 04:55:31
>>21
P‚Ę‚©RŽg‚¦‚Į‚Ä‚Ģ‚Ķ‚Ü‚ ‚»‚¤‚Č‚ń‚¾‚Æ‚ĒAHTML‚Ģ‘Ć“–«‚Ę‚©ƒGƒ“ƒR[ƒfƒBƒ“ƒO‚š‹C‚É‚µ‚Č‚¢‚Å
‚¢‚¢Žg‚¢“¹‚ōl‚¦‚Ä‚½(ŒĀl“I‚É‚»‚¤‚¢‚¤Žł—v‚Ŗ‚ ‚é)‚Ģ‚Å‚ĖB
HTML‚ÉŠÖ‚µ‚Ä‚Ķ‚«‚æ‚ń‚Ę‚µ‚½ƒhƒLƒ…ƒƒ“ƒg‚Č‚ēxgawk‚Å‚Ē‚¤‚É‚©‚Č‚é?




23 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/03/14(…) 16:26:36
ĢAFortranAC‚®‚ē‚¢‚µ‚©’m‚ē‚Č‚©‚Į‚½ŽžA
u‚¦‚ĮA‚±‚ń‚Ȑ”s‚ÅŒvŽZo—ˆ‚é‚ĢHv
uƒvƒƒOƒ‰ƒ€“ą‚Ƀtƒ@ƒCƒ‹–¼‘‚©‚Č‚­‚Ä—Ē‚¢‚ĢHv
u‚±‚Ģ”s‚ŁA‚·‚ׂĂĢƒf[ƒ^‚ĢŒvŽZ‚µ‚Ä‚­‚ź‚é‚ĢHv
‚Į‚āA‹Į‚«‚Č‚Ŗ‚ē—Fl‚É‹³‚¦‚Ä‚ą‚ē‚¢‚Ü‚µ‚½B
”‚Č‚ēAExcel‚Å‚·‚é‚ꂤ‚ČŒvŽZ‚Ķ‚·‚ׂÄawk‚Å‚µ‚Ä‚Ü‚µ‚½B
ƒAƒXƒL[‚©‚ē256”{ƒVƒŠ[ƒY‚Ŗo‚½‚®‚ē‚¢‚¾‚©‚ē
’–Ś‚ĢŒ¾Œź‚¾‚Į‚½‚ń‚¾‚ę‚ĖB



24 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/03/14(…) 16:40:22
Visicalc‚Ę1-2-3‚Ķawkƒu[ƒ€‚ę‚čĢ‚©‚ē‚ ‚Į‚½‚ń‚¾‚Æ‚Ē‚ĖB
UNIX‚Į‚ĈӊO‚ĘŒĆ‚­‚Č‚¢‚ń‚¾‚ę‚ĖB

25 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/04/14(“y) 08:00:42
>10
”­sŠ‚ŖV‹IŒ³ŽŠ‚ĢuƒvƒƒOƒ‰ƒ~ƒ“ƒOŒ¾ŒźAWKv‚š2005”N‚É’č‰æ3465‰~iÅžj‚Å”ƒ‚¢‚Ü‚µ‚½B
‰œ•t‚Ɂu–{‘‚Ķ1989”N11ŒŽ‚ÉŠ”Ž®‰ļŽŠƒgƒbƒpƒ“‚ę‚č”­s‚³‚ź‚Ü‚µ‚½B‚±‚Ģ“xAŠ”Ž®‰ļŽŠV‹IŒ³ŽŠ‚ę‚čAŒ“o”ÅŽŠA–óŽŅ‚Ģ‹–‰Ā‚š“¾‚čĔ­s‚¢‚½‚µ‚Ü‚µ‚½Bv‚ʏ‘‚©‚ź‚Ä‚¢‚Ü‚·B

26 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/04/14(“y) 09:43:47
V‹IŒ³ŽŠ‚Į‚ÄRPG‚Ģ–{‚µ‚©o‚µ‚Ä‚Č‚¢‚ĘŽv‚Į‚Ä‚½‚©‚ēˆÓŠO‚¾B


27 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/04/14(“y) 13:42:47
‘åĢ‚É’Ź‚Į‚Ä‚½‚ź‚Ģ“y–ŲHŠw‰Č‚É‚Ķawk‚ĢŽö‹Ę‚Ŗ‚ ‚Į‚½
ŽĄŒ±‚Ģƒf[ƒ^ˆ—‚É‚Å‚ąŽg‚Į‚Ä‚Ł‚µ‚©‚Į‚½‚ń‚¾‚ė‚¤

28 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/04/16(ŒŽ) 17:34:08
>24
awkƒu[ƒ€‚ĶA¼—ļ‚¾‚ʉ½”N ‚Å‚µ‚傤‚©?

29 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/04/17(‰Ī) 00:31:15
>>28
DOS––ŠśB256”{–{‚Ŗo‚½93”N ‚Ŗƒs[ƒN‚Å‚ĶB
Œć‚ĢPerl‚Ę‚Ķ”äŠr‚É‚Č‚ē‚Č‚¢ƒvƒ`ƒu[ƒ€‚¾‚Æ‚ĒB

30 F28F2007/04/17(‰Ī) 08:45:33
>29
Œä‰ń“š‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B

31 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/05/04(‹ą) 21:28:49
Å‹ß‚Ģī•ń‚ĶA‚±‚æ‚ēI
ttp://gauc.no-ip.org/

32 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/07/14(“y) 08:27:58
‹SŽŌawk‚š’N‚©ģ‚Į‚Ä‚­‚ź‚Č‚¢‚©‚ȁ[


33 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/07/15(“ś) 03:17:40
>>32
‚¢‚¢‚±‚ĘŒ¾‚¤‚Ė‚„B
Ž^¬!

34 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/03(ŒŽ) 08:59:45
‚ ‚Ęƒ[ƒJƒ‹•Ļ”‚Ŗ—~‚µ‚¢‚Č

35 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/03(ŒŽ) 10:30:14
function‚Ģ’†‚Ķƒ[ƒJƒ‹•Ļ”‚É‚Č‚é‚ęB

36 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/04(‰Ī) 00:12:17
‚¢‚Ā‚©‚ēH–¢‚¾‚Ɉų”‚É•Ą‚ׂ邹‚ń‚¾‚ʁB

37 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/04(‰Ī) 09:33:02
‚ [A‚²‚ß‚ńAˆų”•Ą‚ׂ½‚ā‚Ā‚Ŗƒ[ƒJƒ‹•Ļ”‚É‚Č‚éB‚¾‚Į‚½B
ę‚ɐ錾‚·‚ź‚Ī‚¢‚¢‚ń‚¾‚©‚ē•Ź‚É‚ę‚­‚ĖH

38 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/09(“ś) 04:42:02
ƒLƒ‚‚¢‚ā‚ńB‚»‚Ģ‚ā‚č•ūB

39 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/14(‹ą) 04:37:24
‚±‚ź‚©‚ēawk‚š•×‹­‚µ‚Ü‚·B

40 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/14(‹ą) 09:05:13
awk‚šŠw‚Ō‚±‚Ę‚É‚Č‚é‚Å‚µ‚傤B

41 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/15(“y) 01:03:04
‚Ż‚Č‚³‚ńawk‚ĶŒź‚ē‚Č‚¢‚Ģ‚Å‚·‚ĖB

42 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/15(“y) 10:28:44
‘D“Ŗawk‚µ‚Ä‘DŽR‚É“o‚éB

43 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/16(“ś) 03:03:51
l‚ÉŒ¾‚¦‚é‚Ł‚Ēawk’m‚Į‚Ä‚é–ó‚Å‚ą–³‚¢‚µ

44 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/16(“ś) 10:27:22
‚¾‚Æ‚Ēl‚Ģ˜b‚Ķ•·‚«‚½‚¢‚µ

45 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/17(ŒŽ) 18:12:15
awk‚Ś—˜’Ź

46 Fcat.awkF2007/09/19(…) 08:55:44
1

47 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/19(…) 16:41:49
awk‚š•×‹­‚µ‚Ä‚¢‚é‚Ģ‚Å‚·‚ŖAPerl‚ÉŠµ‚ź‚Ä‚¢‚é‚©‚ē‚©
awk‚Å‚Å‚«‚邱‚Ę‚ĶPerl‚яƒ“ƒ‰ƒCƒi[‚Å‚ā‚Į‚½‚Ł‚¤‚Ŗ(­‚Č‚­‚Ę‚ąŽ©•Ŗ‚É‚Ę‚Į‚Ä‚Ķ)‘¬‚¢‹C‚Ŗ‚µ‚Ä‚Č‚č‚Ü‚¹‚ńB
‚±‚ź‚É‚Ā‚¢‚Äawkn—ūŽŅ‚Å‚ ‚éŠF—l‚Ķ‚¢‚©‚Ŗ‚؍l‚¦‚É‚Č‚č‚Ü‚·‚©H
‚±‚¤‚¢‚¤Žž‚Ķawk‚Ģ‚Ł‚¤‚Ŗ•Ö—˜I‚Ę‚¢‚¤—į‚É‚Ķ‚Ē‚ń‚Č‚ą‚Ģ‚Ŗ‚ ‚č‚Ü‚·‚©H

48 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/19(…) 16:43:11
Ŗ‚ ‚Į‘¬‚¢‚Ę‚¢‚¤‚Ģ‚ĶAƒR[ƒh‚š‘‚­‚Ģ‚Ŗ‘¬‚¢‚Ę‚¢‚¤ˆÓ–”‚Å‚·B

49 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/19(…) 16:48:06
>>47
perl ‚Ķ‚Č‚­‚Ä‚ą awk ‚Č‚ē“ü‚Į‚Ä‚¢‚鎖‚Ŗ‚ ‚é

50 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/19(…) 16:53:58
uƒR[ƒh‚š‘‚­‚Ģ‚Ŗ‘¬‚¢v‚Ę‚¢‚¤Šī€‚ŁA
u‚±‚¤‚¢‚¤Žž‚Ķawk‚Ģ‚Ł‚¤‚Ŗ•Ö—˜v‚Ę‚¢‚¤—į‚š‘¼l‚É‹“‚°‚³‚¹‚Ä‚ąA
‚»‚ź‚Ķ‚»‚ĢlŠŌ‚É‚Ę‚Į‚Ä‚Ģ‘¬‚¢‹C‚Ŗ‚·‚é•Ö—˜‚³‚Å‚ ‚Į‚āA
ˆÓ–”‚Ģ‚ ‚éˆź”Ź“I‚Č‹c˜_‚É‚Č‚ē‚Č‚¢‚Ģ‚Å‚Ķ‚Č‚¢‚©H

51 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/19(…) 16:57:51
Perl‚ąRuby‚ąPython‚ąŽg‚¤‚Æ‚ĒA“Į’č‚ĢƒJƒ‰ƒ€‚¾‚Æ‚É‹»–”‚Ŗ‚ ‚éƒP[ƒX‚Ķ
–³ˆÓŽÆ‚Éawk‚šŽg‚¤‚±‚Ę‚ą‚ ‚éB

perl -a ‚Ę‚© cut‚µ‚Äpaste‚Ę‚©‚ą‚ ‚é‚Æ‚ĒB


52 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/19(…) 18:19:27
>>49 ŠĀ‹«‚É‚ę‚ē‚ø“ü‚Į‚Ä‚¢‚é‚Ę‚¢‚¤‚±‚Ę‚Å‚·‚ĖB

>>50@‚»‚¤‚Å‚·‚ĖB
‚Č‚ŗawk‚Č‚Ģ‚©A
ˆź”Ź“I‚É‚Ķ‚Ē‚¤‚¢‚¤Žž‚Éawk‚ŖŽg‚ķ‚ź‚é‚Ģ‚©A
‚Ę‚¢‚¤‚Ģ‚ŖƒCƒ}ƒCƒ`Ž©•Ŗ‚Ģ‚Č‚©‚Å•Ŗ‚©‚Į‚Ä‚¢‚Č‚¢‚Ģ‚Å‚·B

>>51 ­‚µ•×‹­‚µ‚½ŒĄ‚č‚Å‚ĶAŠm‚©‚ɃJƒ‰ƒ€‚ĢŽę‚čo‚µ‚Ķawk‚Ŗ•Ö—˜‚Č‚Ģ‚©‚ą‚ĘŽv‚¢‚Ü‚µ‚½B



53 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/19(…) 19:55:33
>>52
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚Ģ’†‚ŁA•nŽć‚ČƒVƒFƒ‹‚ĢŒvŽZ”\—Ķ‚š
•ā‚¤‚½‚߂ɁAƒc[ƒ‹ƒ{ƒbƒNƒX‚Ģˆź‚Ā‚Ę‚µ‚ÄŽg‚ķ‚ź‚邱‚Ę‚Ŗ‘½‚¢B

‚Ģ‚ŁAƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚š‘‚­‹@‰ļ‚Ŗ‘½‚¢‚Ģ‚Č‚ēA‚ā‚Į‚Ä‚Ø‚¢‚Ä
‘¹‚Ķ–³‚¢‚ĘŽv‚¤‚ŖAƒtƒbƒgƒvƒŠƒ“ƒg‚Ŗ‘½­ƒfƒJƒC‚±‚Ę‚Ę‚ā‚āˆŚA«‚É
Œ‡‚Ƃ邱‚Ę‚š‹C‚É‚µ‚Č‚Æ‚ź‚ĪA•Ź‚ÉPerlŽg‚Į‚½‚Į‚Ä‚¢‚¢‚ķ‚Æ‚¾
i‚Ē‚¤‚¹”‚Č‚ē‘å’ļ‚ĶŽg‚¦‚邾‚ė‚¤‚µAawk‚É‚µ‚Ä‚ąˆź‰žPosix•W€‚¾‚Ŗ
FX•ĻŽķ‚Ŗ‚ ‚éjB

‚܁A’P‚É•Ö—˜‚ČƒXƒNƒŠƒvƒgŒ¾Œź‚Ŗ—~‚µ‚¢‚¾‚Æ‚Č‚ēA”Xawk‚š‚ā‚éˆÓ–”‚Ķ
‚Ł‚Ę‚ń‚Ē‚Č‚¢‚¾‚ė‚¤B
ƒtƒB[ƒ‹ƒh•ŖŠ„‚¾‚Æ‚Č‚ēperl -a‚Åawk‚Ģ^Ž—‚Ŗ‚Å‚«‚邵‚ȁB

54 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/19(…) 20:06:52
>>53 ’š”J‚Č‚Ø•ŌŽ–‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B
ƒVƒFƒ‹‚ĢŒvŽZ‚Ģ•ā•‚Å‚·‚©B
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚š‘‚­‹@‰ļ‚Ķ‘½­‚Ķ‚ ‚é‚Ģ‚ŁA‘½­‚ĶŠo‚¦‚Ä‚Ø‚±‚¤‚ĘŽv‚¢‚Ü‚·B

55 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/19(…) 21:00:04
awk‚Ęper‚ŒAˆ—‘¬“x‚Ķ‚Ē‚Į‚æ‚Ŗ‘¬‚¢‚ń‚¾‚ėH
‚Į‚ăIƒ}ƒG‚ŖŽŽ‚¹‚Į‚ÄŒ¾‚ķ‚ź‚»‚¤‚¾‚Æ‚Ē‚Ó‚ĘŽv‚Į‚½‚ń‚ŏ‘‚¢‚Ä‚Ż‚½B

56 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/19(…) 22:17:45
awk‚Ķˆ—Œn‘½‚¢‚©‚ē‚Č‚Ÿ
‰½‚Ģˆ—‚©‚É‚ą‚ę‚邾‚ė‚¤‚µ

57 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/19(…) 23:45:00
‚Ē‚æ‚ē‚ą“¾ˆÓ‚Ę‚·‚é’Pƒ‚ČƒeƒLƒXƒg‚ĢƒtƒBƒ‹ƒ^ƒŠƒ“ƒOˆ—‚Č‚ēA
I/O‘¬“x‚Ő§ŒĄ‚³‚ź‚é‚Ģ‚Å‚Ē‚æ‚ē‚Å‚ą(ˆ½‚¢‚Ķsed‚šŽ‚æo‚µ‚Ä‚ą)‘債‚Ä•Ļ‚ķ‚ē‚Č‚¢‚ĘŽv‚¤B

awk‚Ģ^œ’ø‚Ķˆźs–ģ˜Y‚É‚ ‚é‚ĘŽv‚¤Ž„‚ĶA‚±‚ń‚Č‚Ģ‚š‚ę‚­‘‚«ŽĢ‚Ä‚éB
--
awk 'BEGIN {print 1+2*3-4;}'
ls -l /tmp|awk '$5>0'
ls -l |awk '{sum+=$5;} END{print sum;}'

58 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/19(…) 23:51:16
Perl‚É‚½‚¢‚·‚éAwk‚ĢŒ»ŽĄ“IƒƒŠƒbƒg‚Ķƒƒ‚ƒŠĮ”ļ‚Ŗ­‚Č‚¢‚±‚Ę‚­‚ē‚¢‚Å
‚±‚ź‚Ķ”‚ĢŒvŽZ‹@‚Å‚Ķ”÷X‚½‚é–ā‘č‚¾B
ESR‚ĢArt of UNIX Programming‚š—§‚æ“Ē‚Ż‚µ‚½‚ē
Awk‚Ŗƒƒ‚ƒŠß–ń‚Ģ‚½‚ß‚ÉŽd—l‚š§ŒĄ‚µ‚½‚±‚Ę‚Ŗ
‘Šś‚É‹£‘ˆ—Ķ‚š‚Č‚­‚µ‚½——R‚Ę˜_‚¶‚Ä‚¢‚½B
ƒoƒbƒh‚ČŒ¾ŒźŻŒv‚ĢŒ©–{‚Į‚ÄŠ“‚¶‚ŁA‚æ‚Ę•s–ł‰õ‚¾‚Į‚½

59 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/22(“y) 02:28:36
>>57
‰“‚ąŽžX‚ā‚éB
‚»‚ĢŽž‚Ķ•Ö—˜I‚ĘŽv‚Į‚Ä.cshrc‚Ę‚©‚Éalias“o˜^‚·‚é‚Æ‚Ē‚·‚®‚É–Y‚ź‚Ä“Æ‚¶“ą—e‚šŽč‘ł悵‚Ä‚½‚č‚·‚é
‚»‚Ģ‹“‹å‚É‚±‚ź‚Ķ•Ö—˜I‚ĘŽv‚Į‚Ä.cshrcŠJ‚­‚ĘŠł‚É“o˜^‚µ‚Ä‚ ‚é‚Ę‚¢‚¤c

60 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/22(“y) 09:21:37
>>59
‘S‰“‚Ŗ‹¤Š“‚µ‚½B

61 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/24(ŒŽ) 12:01:33
i.cshrc‚š.bashrc‚É’u‚«Š·‚¦‚āj@‰“‚ą“Æ‚¶ŒoŒ±‚Ŗ‚ ‚éB

62 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/28(‹ą) 00:37:50
uˆźs–ģ˜Yv‚Ķ–¼–ó

63 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/28(‹ą) 01:20:24
‚Ž‚©‚µAu“Ē‘‚·‚éƒvƒƒOƒ‰ƒ}v‚š‚ę‚ń‚ŁAawk‚ʼnļŒv‚š‚·‚é‚Ģ‚Ŗ‚©‚Į‚±—Ē‚¢‚Ę
‚Ø‚ą‚Į‚Ä‚Ü‚µ‚½B
‚Å‚ąŠm’č\‚š‚·‚ég‚É‚Č‚Į‚½‚ēEXCEL‚šŽg‚Į‚Ä‚¢‚éB

uƒGƒ“ƒWƒjƒA‚Ģ‚½‚ß‚ĢŽ––±ģ‹Ę sed awk grep ‚»‚µ‚ÄTexv‚Č‚ń‚Š‚Ŗ‚ ‚ź‚ĪH‚¢‚Ā‚­‚Ģ‚É...


64 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/28(‹ą) 02:53:12
awk‚ʼnļŒv—pƒXƒNƒŠƒvƒg‚š‘‚­‚ę‚čA‰ļŒv‚Ģ‚µ‚­‚Ż‚š—‰š‚·‚邱‚Ę‚Ģ•ū‚Ŗ
‰“‚É‚Ķ—y‚©‚É“ļ‚µ‚¢

65 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/09/28(‹ą) 14:47:04
Perl‚¾‚Æ‚ĒA‚±‚ź‚ĶH
http://www.moge.org/okabe/temp/balance/


66 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/10/02(‰Ī) 02:19:46
Perl ‚ĶƒR[ƒhˆź–ŚŒ©‚ĉ“‚Ŗcore“f‚«‚»‚¤‚É‚Č‚é

67 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/10/02(‰Ī) 07:50:30
”CˆÓ‚É core ‚Ŗ“f‚Æ‚½‚ē•Ö—˜‚¾‚ę‚ȁB“ś‹L‘ć‚ķ‚č‚É‚Č‚éB

68 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/10/02(‰Ī) 08:00:10
>>67
‘ĢŒ^ˆŪŽ‚Ģ‚½‚ß‚É—]‹V‚Č‚­‚³‚ź‚Ä‚¢‚él‚ą‚¢‚½‚ꂤ‚Å‚·B
Žw‚šA‚É“ü‚ź‚é‚ꂤ‚É‚·‚é‚Ģ‚ŁA‘­‚ÉŒ¾‚¤‚°‚ė‚¾‚±‚ŖŽw‚É‚Å‚«‚Ü‚·B

69 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/10/03(…) 23:18:59
awk‚Į‚Ä‚Č‚ń‚ÅPerl•—‚ɐ³‹K•\Œ»’uŠ·‚Å‚«‚é‚ꂤ‚É‚Č‚ē‚ń‚ĢB“ĘŽ©Šg’£‚Å‚ą‚¢‚¢‚ń‚¾‚Æ‚Ē‚ȁB


70 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/10/04(–Ų) 02:48:29
>>69
‚ńA‚­‚ķ‚µ‚­B

Perl‚Ģƒƒ^•¶Žš‚šŽg‚¢‚½‚¢‚Ę‚¢‚¤‚Ģ‚Ę‚Ķˆį‚¤‚Ģ?
#Žg‚¦‚ń‚ķ‚Æ‚¾‚Ŗ


71 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/10/04(–Ų) 21:53:48
awk‚ĶDFA‚Åperl‚ĶNFA‚¾‚Į‚Æ‚©?


72 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/10/05(‹ą) 02:45:00
>>71
ƒIƒŠƒWƒiƒ‹‚Å‚Ķ‚ĖB
’†‚É‚ĶNFA‚šŽg‚Į‚Ä‚¢‚éawk‚ą‚ ‚éBmawk‚Ę‚©B


73 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/11/22(–Ų) 06:36:33
xgawk‚Å‘½”{’·®”‚šŽg‚¢‚½‚¢‚ń‚Å‚·‚ŖA
printf( "%ld\n", num );
‚Å‚ĶŒ…”‚Ķ‘‚¦‚Ä‚ąø“x‚Ķć‚Ŗ‚Į‚Ä‚Č‚¢‚ꂤ‚Å‚·B
Œ^éŒ¾‚·‚é‚É‚Ķ‚Ē‚¤‚·‚é‚Ģ‚Å‚µ‚傤‚©

74 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/11/22(–Ų) 07:17:23
>>73
‘½”{’·®”‚šŽĄ‘•‚·‚é‚Ģ‚ÉŒĀ•Ź‚Ģø“x‚šć‚°‚Ä‚Ē‚¤‚·‚éB

75 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/11/22(–Ų) 07:34:48
xgawk‚Ķ‘½”{’·®”‚ ‚é‚ń‚Å‚·‚ę‚ĖH
‚ŁAruby‚Ģ‚ꂤ‚É–³éŒ¾‚ÅŽg‚¦‚é‚©‚ĘŽv‚Į‚½‚ē‚»‚¤‚Å‚Ķ‚Č‚¢‚ē‚µ‚¢‚Ģ‚ŁA
‚Ē‚¤‚·‚é‚Ģ‚©‚ʁB

http://home.vrweb.de/~juergen.kahrs/gawk/XML/xmlgawk.html
‚¢‚Ü‚±‚Ģ‚Ö‚ńŒ©‚Ä‚é‚ń‚Å‚·‚Ŗ

76 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/11/22(–Ų) 08:47:49
MPFR,‘½”{’·®”‚Å‚Ķ‚Č‚­ŽĄ”‚©‚ȁB
ƒOƒO‚Į‚ÄŒ©‚Ā‚Æ‚Ü‚µ‚½B
http://www.kt.rim.or.jp/~kbk/zakkicho/zakkicho7.html#D060126

http://golf.shinh.org/p.rb?Factorial
ŽĄ‚Ķ‚±‚ź‚ā‚Į‚Ä‚é‚ń‚Å‚·‚ŖB
‚ ‚Ę‚Ķdll‚ĢƒpƒX‚Ŗ•Ŗ‚©‚ź‚ĪEEE

77 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/11/26(ŒŽ) 21:13:28
>>76
u‚ ‚Č‚²‚év‚Ģ xgawk ‚Ķ MPFR Ļ‚ń‚Å‚Č‚¢‚ĘŽv‚¤‚ŖEEEB


78 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2007/11/29(–Ų) 08:00:03
‚»‚¤‚Å‚·‚©
‚Ē‚æ‚ē‚É‚µ‚Ä‚ąŽĄ”‚Į‚ÄŽ–‚Ķ‚ā‚Į‚Ļ–³—‚Č‹C‚Ŗ‚µ‚Ü‚µ‚½

79 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/01/04(‹ą) 07:28:20
sed‚Ż‚½‚¢‚ɁAƒpƒ^[ƒ“•”•Ŗ‚šs”Ō†‚ÅŽw’čo—ˆ‚Ü‚¹‚ń‚©H

80 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/01/04(‹ą) 09:32:19
>>79
awk 'NR == 79 {print;}'
‚Į‚Ä‚±‚Ę? ‚»‚ź‚Ę‚ąA
awk 'FNR == 79 {print;}'
‚Į‚Ä‚±‚Ę?

81 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/01/04(‹ą) 14:24:54
>80
‚Ķ‚¶‚ßsed‚Ż‚½‚¢‚É 10,35{ ‚Ż‚½‚¢‚ČŠ“‚¶‚ɏ‘‚¢‚ă_ƒ‚¾‚Į‚½‚Ģ‚Å; }
•’Ź‚É”äŠrŽ®‘‚­‚ń‚Å‚·‚ĖB10<=NR&&NR<=35{ ‚ŏo—ˆ‚Ü‚µ‚½; }
‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B

82 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/01/05(“y) 00:50:26
>>81
‚ą‚¤­‚µ sed ‚ē‚µ‚­‚µ‚½‚¢‚Č‚ēA
10==NR, NR==35 { print }
‚Č‚ń‚Ä‚Ģ‚ą‚ ‚č

83 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/01/14(ŒŽ) 09:02:50
awk ‚ĶƒIƒvƒVƒ‡ƒ“‚Č‚µ‚¾‚Ęƒƒ“ƒ‰ƒCƒi[‚ĢƒR[ƒh‚š‘‚­‚±‚Ę‚É‚Č‚é‚ĘŽv‚¢‚Ü‚·‚Ŗ
ŽĄŪ awk ‚Ģƒƒ“ƒ‰ƒCƒi[‚Į‚Ä‚Ē‚ń‚ČŽž‚ÉŽg‚¢‚Ü‚·‚©H
‚ ‚Ü‚čŒ©‚½‚±‚Ę‚Ŗ‚Č‚­‚āc

84 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/01/14(ŒŽ) 09:45:08
>>83
UNIX‚Å‚Ķ‘½‚­‚Ģƒtƒ@ƒCƒ‹‚āo—Ķ‚Ŗ—“‹ęŲ‚čƒeƒLƒXƒg‚ĢŒ`Ž®‚É‚Č‚Į‚Ä‚¢‚é‚©‚ē
‚»‚ĢźŽg‚¢ŽĢ‚ăƒ“ƒ‰ƒCƒi[‚Ŗ–{—ˆ‚ĢŽg‚¢•ū‚Č‚ń‚¾‚Æ‚ĒA
‘¼‚ĢOS‚¾‚Ę BEGIN ‚š main ‘ć‚ķ‚č‚ÉŽg‚¤‚ꂤ‚Č‚Ģ‚Ī‚Į‚©‚É‚Č‚é‚©‚ą‚ĖB

85 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/01/14(ŒŽ) 09:46:06
>>83‚Ŗsed‚š‚Ē‚¤Žg‚Į‚Ä‚¢‚é‚Ģ‚©‹C‚É‚Č‚éB
sedƒXƒNƒŠƒvƒgƒtƒ@ƒCƒ‹‚Ę‚©ģ‚Į‚āAƒXƒNƒŠƒvƒg‚Ģˆų”‚ɏˆ—‘ĪŪ‚Ģƒtƒ@ƒCƒ‹‚š“n‚µ‚Ä‚½‚č‚·‚é‚Ģ‚©‚ȁB

86 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/01/14(ŒŽ) 10:18:29
‚ę‚­‘‚­ˆźs–ģ˜YB
--
du -sk /tmp/* | awk '{sum += $1;} END {print sum / NR;}'
# ‚Ü‚ŸAdu‚Į‚Ä‚Ģ‚Ķ”Žv‚¢‚Ā‚¢‚½‚¾‚ƂŁAŽĄŪ‚Édu‚Ģo—Ķ‚Ģ•½‹Ļ‚šŽę‚邱‚Ę‚Ķ‚Č‚¢‚Æ‚Ē‚ĖB
--
paste foo bar | awk '($1 - $2) > 1e-3 || ($1 - $2) < -1e-3 {print NR, $0;}'
# ˆź’v‚šŒ©‚邾‚Æ‚Č‚ēdiff‚Å‚¢‚¢‚Æ‚ĒA‹ßŽ—‚šŒ©‚é‚É‚ĶŽg‚¦‚Č‚¢‚ń‚ŁB

87 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/01/15(‰Ī) 18:34:44
>>85
sed‚Ķ’P‘Ģ‚Ģ–½—ß‚šŒ©‚āu’uŠ·vus‚ĢŲ‚čŽĢ‚āv‚Ż‚½‚¢‚Č—p“r‚Ŗ
ƒpƒb‚ĘŒ©‚ÄŽv‚¢•t‚­‚Ģ‚Å‹^–ā‚Ķ•¦‚©‚Č‚¢‚ń‚Å‚·B

awk‚Ķ‚Š‚Ę‚Ā‚Š‚Ę‚Ā‚Ģ–½—ß‚šŒ©‚Ä‚ą
•’Ź‚ɃXƒNƒŠƒvƒgŒ¾Œź‚Ģ–½—ß‚Ę‚µ‚©Žv‚¦‚Č‚¢‚Ģ‚Å
uƒR[ƒh‘‚­‚Č‚ē‚Ę‚ą‚©‚­Aƒƒ“ƒ‰ƒCƒi[‚Å‚Ē‚¤Žg‚¤‚ĢHv‚Ę
‹^–ā‚š‚ą‚Į‚Ä‚µ‚Ü‚¤‚ń‚Å‚·B

>>86
‚¤`‚ńAŒ‹\•”ŽG‚É‚Č‚č‚Ü‚·‚ĖB
‚»‚ź‚¾‚ĘŽ„‚Č‚ēƒ^[ƒ~ƒiƒ‹‚ɏ‘‚©‚ø‚É
ƒR[ƒh‚É‹N‚±‚µ‚Ä‚µ‚Ü‚¢‚»‚¤‚Å‚·B

‚Å‚ąAƒpƒ^[ƒ“‚ĘƒtƒB[ƒ‹ƒh‚šćŽč‚­Žg‚¦‚Ī
FXo—ˆ‚é‹C‚Ŗ‚µ‚Ä‚«‚Ü‚µ‚½B
—į‚š‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B

88 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/01/15(‰Ī) 18:59:18
‚ AƒR[ƒh‘‚«‚»‚¤‚Č‚Ģ‚ĶŒćŽŅ‚Å‚·B
•½‹Ļ‚Ę‚©‡Œv‚Ż‚½‚¢‚Čƒ‚ƒm‚É‚Ķ—Ē‚³‚»‚¤‚Å‚·‚ĖB

89 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/01/15(‰Ī) 19:28:50
”“ś‘‚¢‚½ˆźs–ģ˜YB
--
awk '{for (ic = 1; ic <= NF; ++ic) {if (max < $ic) max = $ic;}} END {print max;}'
--
‚±‚ź‚ą‘SƒtƒB[ƒ‹ƒh‚ÉŠg’£‚µ‚Ä‚¢‚邾‚ƂŁA’P‚ɍőå’l‚š“¾‚Ä‚¢‚邾‚Æ‚¾‚ĖB

90 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/01/22(‰Ī) 16:52:32
‚ę‚­‘‚­ˆźs
du -k|awk '$1 > 10000'
‚Å‚©‚¢ƒfƒŒƒNƒgƒŠ‚š‚³‚Ŗ‚·

91 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/01/29(‰Ī) 23:34:51
‰“‚Ŗ‚ę‚­‘‚­ˆźs–ģ˜Y
$ awk 1 > hoge.sh

92 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/01/31(–Ų) 12:58:14
>>91
‚»‚ź‚ɉ½‚ĢˆÓ–”‚Ŗ?
cat > hoge.sh‚Å‚ąŽ–‚Ŗ‘«‚č‚»‚¤‚¾‚ŖB

93 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/01/31(–Ų) 18:48:07
>92
Windows‚Éawk“ü‚ź‚Ä‚½Žž‚ɁA‚±‚ń‚Čƒwƒ“‚Č•Č‚Ŗ•t‚¢‚Ä‚µ‚Ü‚Į‚½B

94 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/02(“y) 12:38:28
‚·‚Ż‚Ü‚¹‚ńA‰SŽŅ‚Å‚·‚Ŗawk‚ÉŠÖ‚·‚é½Ś‚Ŗ‚±‚±‚µ‚©‚Č‚©‚Į‚½‚Ģ‚ŁB
«‚Ģƒ\[ƒX‚š‘‚¢‚Ä‚¢‚½‚¾‚¢‚½‚Ģ‚Å‚·‚ŖA‚¢‚Į‚½‚¢‚Ē‚¤‚·‚ź‚ĪŽg‚¦‚é‚Ģ‚Å‚µ‚傤‚©H
‚æ‚Č‚Ż‚ɁA‚±‚ź‚ĶƒtƒHƒ‹ƒ_“ą‚ĢWinrarŒ`Ž®ƒtƒ@ƒCƒ‹‚ĢƒŠƒJƒoƒŠƒŒƒR[ƒh‚Ŗ•t‚¢‚Ä‚¢‚é‚©”Ū‚©
ƒŠƒXƒg‚šˆźŠ‡‚ŏo—Ķ‚·‚é‚ą‚Ģ‚Å‚·B
‚ę‚ė‚µ‚±
**************
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚¾‚Æ‚Ēunrar lt sample.rar‚Ģo—Ķ—˜—p‚µ‚ăŠƒXƒg‚šģ‚邾‚Æ
Žg‚¢•ū‚ĶƒpƒCƒv‚Åawk‚É“n‚µ‚ďˆ—unrar lt *.rar | gawk -f rr.awk
awk‚Č‚ń‚©“ü‚Į‚Ä‚Č‚¢‚¾‚ė‚¤‚©‚ē“–‘R‚»‚Ģ‚Ü‚Ü‚¶‚į“®‚©‚Č‚¢

rr.awk
#!/usr/local/bin/gawk

BEGIN {$rr=0; printf "%-30s\t%s\n", "FileName", "RecoveryRecord";}

{if($1=="Solid" && $2=="archive"){
for(i=3;i<=NF;i++) printf "%-30s ",$i;printf "\t";getline;getline;
if($0=="Recovery record is present"){printf "Yes / ";
for(;;){getline;if($0=="Data header type: RR"){getline;printf "%sbyte\n",$2;break;}}
}else printf "No\n";}}


95 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/02(“y) 13:01:48
‚»‚ź‚š“®‚©‚·‚É‚Ķ‚Ü‚ø gawk ‚š‚Ē‚±‚©‚©‚ē“üŽč‚·‚éB

96 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/02(“y) 17:48:45
>>94
>«‚Ģƒ\[ƒX‚š‘‚¢‚Ä‚¢‚½‚¾‚¢‚½‚Ģ‚Å‚·‚ŖA

‘‚¢‚½l‚É•·‚­B

‚Ę“š‚¦‚é‚ʁA‚ķ‚Æ‚Ģ‚ķ‚©‚ē‚ń——R‚šŒ¾‚Į‚Ä‚²‚Ė‚邾‚ė‚¤‚©‚ēA
ę‚ÉŒ¾‚Į‚Ę‚­‚ʁA‚»‚ń‚ČŒ©‹ź‚µ‚¢Œ¾‚¢–ó‚·‚é‚ȁB

‚Ē‚¤‚¹“š‚¦‚½‚Į‚āA”“x‚Ķ››‚Ŗ‚ķ‚©‚č‚Ü‚¹‚ń‚Ę‚©Œ¾‚¢o‚·‚ń‚¾‚ėH
‚Ē‚Į‚©‚©‚ēgawk‚š—Ž‚Ę‚µ‚Ä“WŠJ‚µ‚ė‚ęB‘S‚­Aˆź¶ƒOƒO‚Į‚Ä‚ė‚ęƒJƒX
"C:\Program Files\WinRAR\UnRAR.exe" lt *.rar | "gawk‚Ģƒtƒ‹ƒpƒX" -f rr.awk


97 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/10(“ś) 19:16:33
‚·‚¢‚Ü‚¹‚ńA‚ ‚éƒeƒLƒXƒg‚š{print $1,$2}‚Ę‚µ‚Ä’Šo‚µ‚Ä

aaa 1
aaa 2
aaa 3
bbb 1
bbb 2
ccc 1
ccc 4
...

‚Ę‚Ü‚Å‚Ķ‚Å‚«‚½‚ń‚Å‚·‚ŖA•Ą‚ń‚Å‚¢‚éƒf[ƒ^‚š‚»‚ź‚¼‚źA

aaa 6
bbb 3
ccc 5

‚ʏWŒv‚µ‚½‚¢‚ń‚Å‚·‚ŖA‚Ē‚Ģ‚ꂤ‚É‚·‚ź‚Ī‚¢‚¢‚Å‚µ‚傤‚©H

98 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/10(“ś) 19:28:07
awk '{count[$1] += $2;} END{for (aaa in count) {print aaa count[aaa]}}'
‚ ‚Ę‚Ķƒ\[ƒg‚·‚ź‚Ī‚¢‚¢‚Ķ‚ø

99 F97F2008/02/10(“ś) 20:22:03
>98‚³‚ńA‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·I
ī‚Æ‚Č‚¢‚Ģ‚Å‚·‚ŖA”‚Ü‚Å•Ö—˜‚Čƒc[ƒ‹‚É—Š‚Į‚Ä‚¢‚Ä‘S‘RƒRƒ}ƒ“ƒh‚É‚Ā‚¢‚Ä—‰š‚Å‚«‚Ä‚¢‚Č‚©‚Į‚½‚Ģ‚ō¢‚Į‚Ä‚¢‚Ü‚µ‚½B
ŽĄ‚Ķƒ[ƒ‹ƒƒO‚Å‘—MŽŅ‚Ŗ‚Ē‚ź‚¾‚Æ‚Ģ’Ź”‚š‘—M‚µ‚Ä‚é‚©‚šŠm‚©‚߂邽‚߂ɃRƒ}ƒ“ƒh‚Å‚Å‚«‚Č‚¢‚©A‚Å>97‚Å‚Ā‚Ü‚Ć‚¢‚Ä‚¢‚Ü‚µ‚½B
‰½‚Ę‚©“r’†‚Ü‚Å‚Å‚«‚½‚ń‚Å‚·‚ŖA”ńķ‚ɃX[ƒp[ƒGƒŒƒKƒ“ƒg‚Č1sƒR[ƒh‚Å‚µ‚ācB

Žæ–ā‚Ā‚¢‚łŐ\‚µ–ó‚Č‚¢‚Ģ‚Å‚·‚ŖA
(aaa in count) {print aaa count[aaa]}
‚Ģaaa‚É‚Ā‚¢‚Ä‚Ķ‚Ē‚¤‰šŽß‚·‚ź‚Ī‚¢‚¢‚Ģ‚Å‚µ‚傤‚©H



100 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/10(“ś) 20:33:27
>>99
bash‚Ę‚©‚Ģfor‚Ę‚©‚Ę“Æ‚¶‚Å“K“–‚Č•¶Žš—ń‚Č‚ē‚Č‚ń‚Å‚ą‚¢‚¢‚Å‚·D—į‚ɏo‚Ä‚«‚½aaa‚Č‚ń‚©‚É‚·‚é‚©‚ē‚ā‚ā‚±‚µ‚­‚Č‚Į‚Ä‚·‚Ż‚Ü‚¹‚ńD
for(hoge in list) {...}
‚Å”z—ńlist‚ĢƒL[‚š•Š‚Į’[‚©‚ēhoge‚É“ü‚ź‚㋁[ƒv‚·‚é‚Į‚ĈӖ”‚É‚Č‚é‚Ķ‚ø‚Å‚·‚ęD

101 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/10(“ś) 20:36:22
98‚¶‚į‚Č‚¢‚Æ‚Ē

awk '{count[$1] += $2;} END{for (i in count) {printf "%s %i\n", i, count[i]}}'

‚±‚¤‚ā‚Į‚ď‘‚Æ‚Ī‚µ‚ń‚¹‚Ā‚¶‚į‚ĖH
ƒf[ƒ^‚Ģ’†‚Ģaaa‚ĘloopƒJƒEƒ“ƒ^[‚Ģaaa‚š“Æ‚¶–¼‘O‚É‚·‚é‚Ģ‚ĶˆÓ’nˆ«‚¾‚ĘŽv‚¤‚ę



102 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/10(“ś) 20:37:23
101‚Å‚·B‚·‚Ü‚ńonz


103 F‚98F2008/02/10(“ś) 20:39:44
‚ [A‚Ż‚ń‚ȏ‘‚¢‚Ä‚¢‚é‚©‚ēŽ„‚Ģ‘‚¢‚½‚Ģ‚Ķ‘啝‚ɍķ‚é‚©B
‚»‚ĢENDƒuƒƒbƒN“ą‚ĶA
for (§Œä•Ļ” in ˜A‘z”z—ń) {...;}
‚Ę‚¢‚¤ƒpƒ^[ƒ“B

‚»‚Ģ‘O’i‚Ģcount[$1] += $2‚Ķˆźs–Ś‚Ģ‚Ę‚«
count["aaa"] += 1‚ʉšŽß‚³‚ź‚éBˆČ‰ŗ“Æ—l‚ɁB
‚±‚Ģcount‚Ŗ˜A‘z”z—ń‚Ę‚µ‚ÄŽg‚ķ‚ź‚Ä‚¢‚é‚Ę‚¢‚¤‚±‚ʁB

104 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/10(“ś) 20:42:05
>>101
c”½Č‚µ‚Ä‚Ü‚·

‚¢‚āC‚Ł‚ēC‚Ā‚¢‚¢‚Ā‚ą‚ĢƒNƒZ‚Łc‚²‚ß‚ń

105 F97F2008/02/10(“ś) 20:52:15
‚¢‚¦‚¢‚¦‚¢‚¦‚¢‚¦c‚»‚¤‚¢‚¤ˆÓ–”‚¶‚į‚Č‚­‚Ä‹³‚ķ‚Į‚Ä‚¢‚Č‚Ŗ‚ē‚·‚¢‚Ü‚¹‚ń‚Å‚·B
ć‹L‚ŏ‘‚¢‚½‚Ę‚Ø‚č•Ö—˜ƒc[ƒ‹‚É—Š‚čŲ‚Į‚Ä‚Ä–w‚Ē’m‚ē‚Č‚¢Ž„‚Ŗˆ«‚¢‚Ģ‚Å‚·‚ŖcB
”ˆź¶Œœ–½3byte’ö“x‚Ģ”]‚Ż‚»‚ŕ׋­‚µ‚Ä‚é‚ń‚Å‚·‚ŖA2“ś–Ś‚ōĮÜ‚µ‚»‚¤‚ÅŽæ–ā‚³‚¹‚Ä–į‚¢‚Ü‚µ‚½cB

‚½‚Ę‚¦‚ĪƒƒO‚É‚Ķ
Feb 9 22:44:40 localhost postfix/qmgr[1936]: 345C48C0154: from=<use1@example.com>, size=556, nrcpt=1 (queue active)
‚Ę•K‚øo‚Ü‚·B‚ŁA
1,¶ƒƒO‚š‚»‚Ģ‚܂܏ˆ—‚·‚é‚Ģ‚Ŗ•|‚¢i‘å‚«‚Čƒtƒ@ƒCƒ‹j‚Ģ‚ŁA“ś•t‚эƒO‚š’Šo‚µ‚Ä•Źƒtƒ@ƒCƒ‹‚Ö•Ū‘¶B
2,grep‚Å nrcpt=‚Ę’Šo‚µ‚āA‚³‚ē‚Égrep -v‚ŏœŠO‚·‚éƒhƒƒCƒ“‚šŽw’肵‚Ä’Šo
3,‚»‚µ‚Äsed‚Ånrcpt=‚šķœ‚µ‚Ä
4,‚±‚±‚Å>97‚Ģ‚ꂤ‚É$7‚Ę$9‚š•Ą‚ׂ½‚Ę‚±‚ė‚Å”]‚Ż‚»‚Ģƒoƒbƒtƒ@ƒGƒ‰[‚š‹N‚±‚µ‚Ü‚µ‚½B

‚±‚Ģˆ—‚Ģ•ū–@‚ąƒGƒŒƒKƒ“ƒg‚Č‚±‚Ę‚Ķ•Ŗ‚©‚Į‚Ä‚¢‚Ü‚·‚ŖA’p‚Ķ³’m‚Å‚ØŽf‚¢‚µ‚½ŽŸ‘ę‚Å‚·cB

106 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/13(…) 07:31:34
gsub‚Å[.*]‚š’u‚«Š·‚¦‚é‚É‚Ķ‚Ē‚¤‚·‚ź‚Ī‚¢‚¢‚Å‚µ‚傤‚©H

107 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/14(–Ų) 02:38:02
>>106
‚»‚ź‚ĶƒŠƒeƒ‰ƒ‹‚Ę‚µ‚Ĉµ‚Į‚Ä‚Ę‚¢‚¤‚±‚Ę‚©‚¢?
‚Č‚ē‘S•”ƒGƒXƒP[ƒv‚·‚ź‚Ī‚¢‚¢‚ĘŽv‚¤‚Ŗ‰½‚©–ā‘č‚Ŗ‚ ‚é‚Ģ?


108 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/16(“y) 01:08:44
awk‚ÅŒ»ŻŽž‚©‚ēn•Ŗ‘O‚©‚ēˆČ~‚ĢƒƒO‚¾‚Æ‚š”²‚«o‚µ‚½‚¢‚ń‚Å‚·‚ŖA‚Ē‚¤‚·‚ź‚Ī‚¢‚¢‚Å‚µ‚傤‚©cB
02 15 12:34:56 xxxxxxxxx
02 15 13:45:01 xxxxxxxxx
...
...
...
‚Ę‚©‚ĢŒ`Ž®‚Č‚Ģ‚ŁAstrftime()‚Ę‚©‚ÅŒ»Ż‚ĘƒƒO‚ĢŽž‚š”äŠr‚µ‚Ä”²‚«o‚·A‚Ę‚©‚šŽŽ‚µ‚½‚ń‚Å‚·‚Ŗƒ_ƒ‚Å‚µ‚½c

109 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/16(“y) 01:49:16
>>108 ‚±‚ź‚Å‘Ź–Ś‚©‚ȁH(ˆź‰ž gawk 3.0.4 ‚Å‚Ķ“®‚¢‚½)
BEGIN{
n=5
basetime=strftime("%m %d %H:%M:%S", systime()-60*n)
}
{
chktime=substr($0, 1, 14)
if(chktime >= basetime) print
}

110 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/16(“y) 02:23:28
>109

‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·c‘f’¼‚É–Ś‚Ŗ—Ų‚Å‚µ‚½cB

> chktime=substr($0, 1, 14)

‚Č‚ń‚Å‚·‚Ėc
perl‚ŖŽg‚¦‚Č‚¢ŠĀ‹«‚Č‚Ģ‚ŁA‚±‚ź‚Ŗ•Ŗ‚©‚ź‚Ī‚¢‚ė‚¢‚ė—¬—pŒų‚­‚Ģ‚ŏ•‚©‚č‚Ü‚µ‚½B
‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B‚ą‚¤‚æ‚å‚Į‚ʐøi‚µ‚Ü‚·BBB

111 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/18(ŒŽ) 18:58:36
>>29
š”N6ŒŽ‚ɁuAWK‚š256”{Žg‚¤‚½‚ß‚Ģ–{v‚Ŗ–{‰®‚Ģ‘’I‚É‚ ‚Į‚½‚Ģ‚Å”ƒ‚¢‚Ü‚µ‚½B
‰œ•t‚É
1993”N8ŒŽ21“ś‰”Å”­s
2007”N5ŒŽ9“ś@‘ę1”Å‘ę16ü”­s
‚ʏ‘‚©‚ź‚Ä‚¢‚Ü‚·B

112 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/18(ŒŽ) 22:32:44
>>111
‚¢‚Ā‚ĢƒŒƒX‚ɃŒƒX‚µ‚Ä‚ń‚¾i‚—

ÓŚ‚ą”ƒ‚Į‚½‚Æ‚ĒA‚Ü‚¾‘å‚«‚Č–{‰®‚ÅŒ©‚©‚Æ‚é‚ĖB


113 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/19(‰Ī) 02:59:17
>2007”N5ŒŽ9“ś@‘ę1”Å‘ę16ü”­s 

–{‰®‚Ģ’I‚Å–°‚葱‚Æ‚Ä‚½‚Į‚Ä‚ķ‚Æ‚¶‚į‚Č‚¢‚Ģ‚©w


114 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/24(“ś) 00:57:13
–Ś‚Ŗ—Ų ‚Ɉź’v‚·‚é“ś–{Œź‚Ģƒy[ƒW –ń 1,920 Œ’† 1 - 20 Œ–Ś (0.24 •b)

115 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/02/24(“ś) 01:00:56
ƒƒK—Ų

116 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/03/28(‹ą) 21:53:28
sed, awk, ruby ‚šŽg‚¤B
‚»‚ź‚¼‚ź“KŽ“KŠ‚ÅŽg‚¤‚Æ‚ĒA
used ‚¾‚Ɓvuawk ‚¾‚Ɓv‚ōĻ‚Ü‚¹‚ē‚ź‚é‚ʁA
•sŽv‹c‚ČŠģ‚Ń‚šŠ“‚¶‚éB

117 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/03/30(“ś) 14:05:33
>>116
‚¤‚æAAIXŽg‚Į‚Ä‚é‚ń‚Åksh+sed+awk+perl‚¾‚ȁB
ruby‚Ŗ•W€‚ŃCƒ“ƒXƒg[ƒ‹‚³‚ź‚Ä‚éŠĀ‹«‚Į‚Ä‚ ‚ń‚Ü‚Č‚¢‚ĘŽv‚¤B

118 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/03/30(“ś) 16:22:26
ŒĆ‚¢ƒT[ƒo‚¾‚ĘPerl‚·‚ē“ü‚Į‚Ä‚Č‚¢Ž–‚Ŗ‚ ‚é‚©‚ēawk‚Ķd•ó‚·‚éB


119 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/06(“ś) 10:26:45
Å‹ß‚Ģgawk‚Ŗƒlƒbƒgƒ[ƒN‚É‚ąŽg‚¦‚é‚Ę’m‚Į‚Ä‚æ‚å‚Į‚Ę‹Į‚¢‚½‚—
ƒJ[ƒjƒnƒ“‚Ģ–{ƒŒƒxƒ‹i‚Ę‚©256”{j‚µ‚©’m‚ē‚Č‚¢l‚Į‚Ä‘½‚¢‚ĘŽv‚¤B

120 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/06(“ś) 12:44:41
ƒm[ƒ}ƒ‹‚Ģawk‚ÅXML‚šŽš‰ŗ‚°‚µ‚½‚肵‚Ä‚¤‚Ü‚­•\Ž¦‚³‚¹‚é‚É‚Ķ‚Ē‚¤‚·‚ź‚Ī‚¢‚¢‚Ģ‚©‚ȁEEE

121 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/06(“ś) 17:09:18
sed‚¾‚Ƃŏ‘‚Æ‚é‚ʁA‰“‚Į‚Ä“ŖƒCƒC‚©‚ą‚Į‚ÄŽv‚¤B

#!/bin/sed -f

122 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/06(“ś) 17:16:17
•¶Žš—ń‚Ģ’Pƒ‚Č’uŠ·‚¾‚Æ‚Č‚ēawk‚ę‚čŠČ’P‚ɏ‘‚Æ‚é‚ń‚¾‚Æ‚ĒB
awk‚ɌŎ·‚µ‚Č‚¢‚Å—Õ‹@‰ž•Ļ‚Ésed‚šŽg‚¤‚Į‚ĈӖ”‚Å‚Č‚ē—v—Ģ‚Ŗ‚¢‚¢‚Ę‚¢‚¤ˆÓ–”‚ÅŒ«‚¢‚Æ‚ĒB
# awk‚ŏ‘‚¢‚½•ū‚ŖŠČ’P‚Č‚±‚Ę‚šsed‚ÅŠę’£‚Į‚ď‘‚¢‚½‚Ģ‚¾‚Ę‚µ‚½‚ēA‚»‚ĢˆÓ–”‚Å‚Ķ“Ŗˆ«‚¢‚Čw

123 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/06(“ś) 17:34:45
awk‚©‚ēsystem‚ÅsedŒÄ‚Ō‚±‚Ę‚ĶŽžX‚ ‚é‚—

124 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/06(“ś) 18:49:04
>>24
awk‚Į‚Ä•\ŒvŽZ‚Ģ‚ꂤ‚ȏˆ—‚É“Į‰»‚µ‚Ä‚Ü‚·‚ę‚ĖB
‚»‚Ģ“_‚Ŗ”ńķ‚Ƀ†ƒj[ƒN‚Ę‚¢‚¤‚©Ž––±ˆ—‚ĢŒ¾Œź‚¾‚ȁA‚ʁB
visicalc(1979)awk(1977)‚Å‚·‚©‚ēawk‚Ģ‚Ł‚¤‚ŖŽįŠ±ŒĆ‚¢‚ń‚Å‚·‚ŖA
•\ŒvŽZ‚ĶƒZƒ‹‚É’¼ŚŽ®‚š‘‚­‚Ę‚¢‚¤”­‘z‚ŖV‚µ‚©‚Į‚½B‚¤‚Ž‚ŽB

125 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/06(“ś) 19:26:56
VisiCalc‚ĢlˆÄŽŅDan Bricklin‚É‚ę‚éƒAƒCƒfƒA‚Ģą–¾
ttp://www.danbricklin.com/history/saiidea.htm

Dan‚Ģ“d‘ģ‚ŖHP‚¶‚į‚Č‚­‚ÄTI‚Č‚Ģ‚ŖˆÓŠO‚ČŠ“‚¶B
The idea for the electronic spreadsheet came to me while I was a student at the Harvard Business School, working on my MBA degree, in the spring of 1978.
Sitting in Aldrich Hall, room 108, I would daydream.
"Imagine if my calculator had a ball in its back, like a mouse..." (I had seen a mouse previously, I think in a demonstration at a conference by Doug Engelbart, and maybe the Alto).
And "..imagine if I had a heads-up display, like in a fighter plane, where I could see the virtual image hanging in the air in front of me.
I could just move my mouse/keyboard calculator around, punch in a few numbers, circle them to get a sum, do some calculations, and answer '10% will be fine!'"
(10% was always the answer in those days when we couldn't do very complicated calculations...)

126 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/07(ŒŽ) 02:52:10
‚Ķ‚¶‚ß‚Ü‚µ‚Ägawk‚ĢŽæ–ā‚Å‚·
‚ØŽč‚·‚«‚ĢŽž‚É‚Å‚ą‚²‰š“š’ø‚Æ‚Ü‚µ‚½‚ē•‚©‚č‚Ü‚·

2ch‚łؘb‚µ‚Ä‚¢‚½‚¾‚¢‚½•ū‚©‚ēgawk‚š‹³‚¦‚Ä’ø‚«‚Ü‚µ‚½
³‹K•\Œ»‚Ń}ƒbƒ`‚µ‚½•”•Ŗ‚Ŗ‚¢‚­‚Ā‚ ‚Į‚Ä‚ą‘S‚Ä‚Ģ‰ÓŠ‚š1ƒAƒNƒVƒ‡ƒ“‚Å•Ū‘¶‚Å‚«‚é—D‚ź‚ą‚Ģ‚Å‚·
“–•ūAŒ¾Œź‚Ķ‘S‚­’m‚ē‚Č‚¢‚Ģ‚Åę‚Ł‚Ē‚܂ŃeƒXƒgŽĄs‚µ‚Ä‚Ķ‹Į‚¢‚Ä‚¢‚Ü‚µ‚½
‚±‚Ģ—D‚ź‚ą‚Ģ‚š”Œć––‰i‚­Žg‚Į‚Ä‚¢‚«‚½‚¢‚Ģ‚Å‚·‚Ŗ
‰ŗ‹L‚ĢŽ–€‚šƒOƒO‚Į‚ÄŒ©‚½‚Ģ‚Å‚·‚Ŗ‚ķ‚©‚č‚Ü‚¹‚ń‚Å‚µ‚½
‚Ē‚Č‚½‚©‚ķ‚©‚é•ū‚Ø‚ē‚ź‚Ü‚µ‚½‚ē‹³‚¦‚ĉŗ‚³‚¢

Ž„‚Ģ‚ā‚č‚½‚¢‚±‚Ę
EEUC‚š“Ē‚Żž‚ń‚ÅS-JIS‚šo—Ķ
EŠł‘¶‚ĢƒeƒLƒXƒg––”ö‚É’Ē‰Į‘‚«ž‚Ż•Ū‘¶
i‹³‚¦‚Ä’ø‚¢‚½ƒXƒNƒŠƒvƒg‚Ķć‘‚«•Ū‘¶‚Č‚Ģ‚ŏo—Ķę‚Ģ“ą—e‚ŖĮ‚¦‚Ä‚µ‚Ü‚¢‚Ü‚·j

‹C’·‚É‘Ņ‚Į‚Ä‚¢‚Ü‚·‚Ģ‚ʼn½‘²‚ę‚ė‚µ‚­‚ØŠč‚¢’v‚µ‚Ü‚·

127 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/07(ŒŽ) 03:10:31
>>126
‘OŽŅ‚Ķawk‚Å‚ā‚é‚ׂ«‚±‚Ę‚Å‚Ķ‚Č‚¢Biconv, nkf‚Č‚Ē‚»‚źź—p‚Ģƒc[ƒ‹‚Ŗ‚ ‚éB
ŒćŽŅ‚ą•K‚ø‚µ‚ąawk‚Ķ•s—vBƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ŖŽg‚¦‚éŠĀ‹«‚Č‚ē•’Ź‚É‚Å‚«‚éB
—į‚¦‚ĪAUnixŒn‚Č‚ē cat append.txt >> original.txt ‚ÅŠł‘¶‚Ģƒtƒ@ƒCƒ‹‚É’Ē‰Į‚Å‚«‚éB
DOSŒn‚Å‚ąAtype append.txt >> original.txt ‚Å‚Å‚«‚éB
—v‚ĶAawk‚Ģ‚¢‚¢‚Ę‚±‚ė‚Ķ‚»‚ź’P‘Ģ‚Å‚Č‚ń‚Å‚ą‚Å‚«‚é(ˆ½‚¢‚Ķ‚Å‚«‚Č‚¢)‚±‚Ę‚Å‚Ķ‚Č‚­A
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ŠĀ‹«‚Å—Ķ‚š”­Šö‚·‚éƒc[ƒ‹‚Å‚ ‚邱‚ʁB

—į‚¦‚ĪA³‹K•\Œ»‚Ń}ƒbƒ`‚µ‚½•¶Žš—ń‚š’uŠ·‚·‚邾‚Æ‚Č‚ēƒeƒLƒXƒgƒGƒfƒBƒ^‚Å‚ą‚Å‚«‚éB
‚ [‚»‚¤‚»‚¤AƒGƒfƒBƒ^‚Ŗ‚ ‚ź‚Ī•¶ŽšƒR[ƒh‚Ģ•ĻŠ·‚ą‚»‚ź‚¾‚Æ‚Å‚Å‚«‚éB
ŠˆąƒeƒLƒXƒgƒGƒfƒBƒ^‚šŽg‚Į‚½‚±‚Ę‚Ŗ‚Č‚¢‚Č‚ēAˆź“x(³‹K•\Œ»ŒŸõ‹@”\A
•¶ŽšƒR[ƒh•ĻŠ·‹@”\‚Ģ‚ ‚é)ƒeƒLƒXƒgƒGƒfƒBƒ^‚šG‚Į‚Ä‚Ż‚é‚Ę‚¢‚¢‚©‚ą‚µ‚ź‚Č‚¢B

128 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/07(ŒŽ) 03:32:54
>>127‚³‚ń
>>126‚Å‚·
‚Ø”ę‚ź‚Ģ‚Ę‚±‚ė‘X‚Ģ‚²‰š“š½‚É‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·
ƒRƒ“ƒo[ƒg‚Ķ•Ź‚Ģƒc[ƒ‹‚ōs‚¤
DOSŠĀ‹«‚Å‚Ķtype append.txt >> o—Ķęƒtƒ@ƒCƒ‹–¼‚Å’Ē‰Į‘‚«ž‚Ż
—¹‰š‚µ‚Ü‚µ‚½
ƒGƒfƒBƒ^[‚ĶGŠŪƒGƒfƒBƒ^[‚šŽg‚Į‚Ä‚¢‚Ü‚·
ƒRƒ“ƒo[ƒg‚Ķo—ˆ‚é‚Ģ‚Å‚·‚ŖŒŸõ‚Ń}ƒbƒ`‚µ‚½•¶Žš—ń‚Ķ1‰ÓŠ‚ø‚ĀƒRƒs[‚Č‚ń‚Å‚·
sakuraƒGƒfƒBƒ^[‚ňźŠ‡ƒRƒs[‚āŲ‚čŽę‚č‚Ŗo—ˆ‚é‚Ę‹³‚¦‚Ä‚­‚ź‚½•ū‚ą‚¢‚Ä‚½‚Ģ‚Å‚·‚Ŗ
sakuraƒGƒfƒBƒ^[‚ĶŽŽ‚µ‚½‚±‚Ę‚Ŗ–³‚¢‚ń‚Å‚·
Ś‚µ‚­‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚µ‚½

129 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/07(ŒŽ) 03:56:33
AAA.txt‚šŠJ‚«h“Œ‹ž(.+?)†Žŗh‚šŒŸõ‚·‚é
ƒ}ƒbƒ`‚µ‚½•””‰ÓŠ‚šˆźŠ‡‚ŃRƒs[‚µ‚ÄTEST.txt‚Ƀy[ƒXƒg‚·‚é

BBB.txt‚šŠJ‚«h“Œ‹ž(.+?)†Žŗh‚šŒŸõ‚·‚é
ƒ}ƒbƒ`‚µ‚½•””‰ÓŠ‚šˆźŠ‡‚ŃRƒs[‚µ‚ÄTEST.txt‚Ģ––”ö‚Ƀy[ƒXƒg‚·‚é

CCC.txt‚šŠJ‚«h“Œ‹ž(.+?)†Žŗh‚šŒŸõ‚·‚é
ƒ}ƒbƒ`‚µ‚½•””‰ÓŠ‚šˆźŠ‡‚ŃRƒs[‚µ‚ÄTEST.txt‚Ģ––”ö‚Ƀy[ƒXƒg‚·‚é

‚ę‚ė‚µ‚­‚ØŠč‚¢‚µ‚Ü‚·

130 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/07(ŒŽ) 04:02:07
>>127‚ĶŒ‹‹Ēawk‚Ģ‰š“š‚Ķ‚µ‚Č‚¢‚Ģ‚É‚Č‚ń‚Å‚µ‚į‚µ‚į‚čo‚Ä‚«‚½‚ĢH
‚Å‚«‚Č‚¢‚¶‚į‚ń

131 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/07(ŒŽ) 06:48:34
>>130
Žæ–ā‚É‹ļ‘Ģ«‚Ŗ‚Č‚¢‚©‚ēˆź”Ź˜_‚š‘‚¢‚½‚¾‚Æ‚¾‚Æ‚ĒB

>>129
awk '/“Œ‹ž(.+?)†Žŗ/ {print > "TEST.txt";}' AAA.txt
awk '/“Œ‹ž(.+?)†Žŗ/ {print >> "TEST.txt";}' BBB.txt
ˆČ‰ŗ“Æ—l‚ɁB

132 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/07(ŒŽ) 12:02:34
>>131
ƒŒƒX‚ ‚č‚Ŗ‚Ę
gawk '/“Œ‹ž(.+?)†Žŗ/ {print > "TEST.txt";}' AAA.txt
gawk '/“Œ‹ž(.+?)†Žŗ/ {print >> "TEST.txt";}' BBB.txt
ƒtƒ@ƒCƒ‹–¼AƒfƒBƒŒƒNƒgƒŠ–¼A‚Ü‚½‚Ķƒ{ƒŠƒ…[ƒ€@ƒ‰ƒxƒ‹‚Ģ\•¶‚ŖŠŌˆį‚Į‚Ä‚¢‚Ü‚·B
gawk3.16‚Å‚ĶŽg‚¦‚Č‚¢H



133 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/07(ŒŽ) 13:29:56
>>132
DOS‚ĢƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĢŽg‚¢•ū‚Ķ‘¼Š‚Å•·‚¢‚Ä‚­‚źB

134 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/07(ŒŽ) 13:38:24
–šŠ‚Ģ‘‹Œū‚Ż‚½‚¢‚Č‘Ī‰ž‚¾‚ȁB


135 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/07(ŒŽ) 13:43:47
DOS‚ĢƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚É‚Ā‚¢‚Ä‚Ķ‘½‚­‚š’m‚ē‚Č‚¢‚ń‚¾‚ęB

136 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/07(ŒŽ) 16:36:42
DOS‚Ģź‡‚Ķ‹ó”’‚šŠÜ‚Žź‡ƒVƒ“ƒOƒ‹ƒNƒH[ƒg‚¶‚įƒ_ƒ‚¾‚©‚ē‚ȁB
ƒ_ƒuƒ‹ƒNƒH[ƒg‚ÅŠ‡‚Į‚Ä’†‚ĢƒR[ƒh‚Ķ
ƒVƒ“ƒOƒ‹ƒNƒH[ƒg‚©AƒGƒXƒP[ƒv‚µ‚ă_ƒuƒ‹ƒNƒH[ƒg“ü‚ź‚é‚©B

ˆź”ŌŠČ’P‚Č‚Ģ‚ĶAƒƒ“ƒ‰ƒCƒi[‚Å‚ąƒtƒ@ƒCƒ‹‚É‹N‚±‚µ‚Ä‚µ‚Ü‚¤‚±‚ʁB
gawk -f myscript.awk AAA.txt
‚Ę‚ā‚Į‚Ä‚µ‚Ü‚¦‚ĪAƒVƒ“ƒOƒ‹ƒNƒH[ƒg‚Ę‚©ƒ_ƒuƒ‹ƒNƒH[ƒg‚Ę‚©‹C‚É‚·‚é•K—v‚Ķ‚Č‚¢B

137 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/07(ŒŽ) 18:22:15
>>132
“ń‚Ā–ā‘č‚Ŗ‚ ‚éB
gawk‚Ģ³‹K•\Œ»‚Å‚Ķ.+?‚Ę‚¢‚¤‚Ģ‚ĶŽg‚¦‚Č‚¢B
cmd.exe‚Å‚ĶAƒVƒ“ƒOƒ‹ƒNƒH[ƒg‚šˆų”‚š
‚­‚­‚é‚Ģ‚ÉŽg‚¦‚Č‚¢B

‚Č‚ń‚©‚ę‚­‚ķ‚©‚ē‚ń‚ŖAperl‚ŃeƒLƒXƒg‚šŠŪˆł‚Ż‚µ‚Ä‚©‚ē
ˆ—‚·‚ź‚Ī‚¢‚¢‚ń‚¶‚į‚Č‚¢‚Ģ‚©H


138 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/12(“y) 19:00:42
VisiCalc ‚Ę‚¢‚¦‚ĪAoŽn‚ß‚Ģ ‚É TRS-80 —p ‚š Radio Shack ‚ÅŒ©‚¹‚Ä‚ą‚ē‚Į‚½‚ń‚¾‚Æ‚ĒAŠw¶‚¾‚Į‚½Ž„‚É‚Ķ‰æ’l‚Ŗ‚ķ‚©‚ē‚Č‚©‚Į‚½‚Č‚ŸB
‚Ü‚ŸA‚±‚ź‚ÉŒĄ‚ē‚øAw‚Č‚ń‚Å‚±‚ń‚ČƒRƒ}ƒ“ƒh‚āƒIƒvƒVƒ‡ƒ“‚Ŗ‚ ‚é‚ń‚¾Hx‚Į‚Ä‚Ģ‚Ķ‘½‚¢B
Žg‚¢•ū‚¶‚į‚Č‚­A‚Č‚ŗ‚»‚ź‚Ŗ‚ ‚é‚Ģ‚©‚š•ļŠ‡“I‚ɉšą‚µ‚½–{‚ā web site ‚Į‚Ä‚ ‚č‚Ü‚·‚©B(‚½‚Ę‚¦‚Ī‘½‚­‚Ģ unix ƒRƒ}ƒ“ƒh‚š–Ō—…‚µ‚Ä‚¢‚é‚Ę‚©)

139 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/12(“y) 19:01:22
‚ ‚ AƒXƒŒˆį‚¢‚¾‚Į‚½B‚²‚ß‚ń‚²‚ß‚ńB

140 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/04/12(“y) 19:58:47
‚Č‚ń‚Ę‚¢‚¤Œė”š


141 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/05/06(‰Ī) 02:42:04
>>132 ‚ą‚¤‹‚Č‚¢‚©‚ȁBgawk3.1.6 + nkf2.0 Žg—p@cmd.exe

C:\work>type aaa.txt (¦EUC‚Č‚Ģ‚ʼn»‚Ƃ鎖‚šŠm”F)
¤Ū¤²¤Ū¤²
ŁEž¹ę¼¼
ŁEž£²¹ę¼¼
ŁEž£±£°¹ę¼¼
ŁEž¤Ū¤²¹ę¼¼
ŁEž¤Õ¤¬¹EŁEÕ¤¬¹ę¼¼
ŁEž£³¹ę¼¼¤ČŁEž£µ¹ę¼¼

C:\work>nkf -Es AAA.txt
‚Ł‚°‚Ł‚°
“Œ‹ž†Žŗ
“Œ‹ž‚Q†Žŗ
“Œ‹ž‚P‚O†Žŗ
“Œ‹ž‚Ł‚°†Žŗ
“Œ‹ž‚Ó‚Ŗ†
“Œ‚Ó‚Ŗ†Žŗ
“Œ‹ž‚R†Žŗ‚Ę“Œ‹ž‚T†Žŗ

C:\work>nkf -Es AAA.txt| gawk "/“Œ‹ž.*†Žŗ/{print $0}"
“Œ‹ž†Žŗ
“Œ‹ž‚Q†Žŗ
“Œ‹ž‚P‚O†Žŗ
“Œ‹ž‚Ł‚°†Žŗ
“Œ‹ž‚R†Žŗ‚Ę“Œ‹ž‚T†Žŗ

Šło‚Ģ’Ź‚蕶Žš•ĻŠ·nkf(>>127) ³‹K•\Œ»‚Ģ§–ń‚ŏšŒ•ĻX(>>137)
ŽĄŪ‚ÉŽg‚¤ź‡‚Ķ‚±‚ń‚ČŠ“‚¶‚Ńoƒbƒ`ģ‚é‚Ę‚©B
C:\work>nkf -Es AAA.txt| gawk "/“Œ‹ž.*†Žŗ/{print $0}" >>TEST.txt


142 F141F2008/05/06(‰Ī) 02:56:02
‚ʁA•ū–@‚š‘‚¢‚Ä‚Ø‚¢‚ăAƒŒ‚¾‚Æ‚ĒA
GŠŪŽg‚Į‚Ä‚é‚Č‚ēgrep‚ĢŽĄs‚ÅŒŸõ‚·‚éƒtƒ@ƒCƒ‹‚É(Œ»Ż‚Ģ“ą—e)‚Å
ŒŸõŒ‹‰Ź‚©‚ēƒtƒ@ƒCƒ‹–¼‚ʍs”Ō†‚šœ‹Ž‚·‚é‚Ģ‚Å‚ą‚Å‚«‚»‚¤‚Č‹C‚Ŗ‚·‚éB
·‘å‚ɃXƒŒˆį‚¢‚¾‚Æ‚ĒB


143 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/05/06(‰Ī) 14:28:43
>>142‚³‚ń
‚ ‚č‚Ŗ‚Ę
‚Ü‚¾Žv‚¤‚ꂤ‚É‚Å‚«‚Ä‚¢‚Č‚¢‚ń‚¾
ŽQl‚É‚Č‚é‚ꊓŽÓ‚Å‚·

144 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/06/16(ŒŽ) 01:50:26
‚Š‚Å‚¦‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—

145 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/06/16(ŒŽ) 01:50:57
‚·‚Ü‚ńŒė”š

146 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/06/25(…) 02:17:58
Žæ–ā‚Å‚·I

ˆČ‰ŗ‚Ģƒtƒ@ƒCƒ‹hoge‚©‚ēawk‚ŁA‰æŠi‚š”²‚«o‚µ‚č‡Œv’l‚šo‚µ‚½‚¢‚ĘŽv‚Į‚Ä‚¢‚Ü‚·B
ƒtƒ@ƒCƒ‹‚Ģ“ą—e‚ĶA‘Š–¼‚ʉæŠi‚Å‚·B‰æŠi‚Ķˆź”ŌŒć‚ė‚Ģ”Žš‚É‚Č‚č‚Ü‚·B

----------------------
$ cat hoge
‚»‚ź‚¢‚ƁI‚ ‚ń‚Ļ‚ń‚Ü‚ń 1000
ƒƒ^ƒ{ƒŠƒbƒN‚šŒ‚‘Ž‚¹‚ę 1000
‰ŗ—¬ŽŠ‰ļ 1000
ć—¬ŽŠ‰ļ‚ʉŗ—¬ŽŠ‰ļ “ś–{‚Ģ‚±‚ź‚©‚ē 1000
˜_•¶ 2008 “ś–{‚Ģ•ų‚¦‚é–ā‘č 1000
˜_•¶ 2007 “ś–{‚Ģ•ų‚¦‚é–ā‘č ‰ß‹Ž–ā‘čW 1000
----------------------

“ļ‚µ‚¢‚Ģ‚ŖA‘Š–¼‚Ģ2008‚ā2007‚Č‚Ē‚Ģ”’l‚ŖŠÜ‚Ü‚ź‚Ä‚¢‚邱‚Ę‚ā‹ó”’‚ŖŠÜ‚Ü‚ź‚Ä‚¢‚邱‚Ę‚Å‚·B
1s–Ś‚Ģź‡2—ń–Ś‚Ŗ‰æŠi‚É‚Č‚č‚Ü‚·‚ŖA2s–Ś‚Ģź‡4—ń–Ś‚Ŗ‰æŠi‚Ę‚Č‚č‚Ü‚·B

‚±‚Ģ‚ꂤ‚Ɉź”ŌÅŒć‚Ģ—ńi‰æŠij‚šŽę“¾‚µA‡Œv’l‚šŒvŽZ‚·‚é‚É‚Ķ‚Ē‚¤‚·‚ź‚Ī‚ę‚¢‚Å‚µ‚傤‚©H

‚²‹³Ž¦‚ØŠč‚¢‚¢‚½‚µ‚Ü‚·B




147 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/06/25(…) 02:28:00
awk '{x+=$NF}END{print x}' hoge

148 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/06/25(…) 09:33:15
x‚¶‚į‚Č‚­‚Äsum‚Ę‚©‚É‚µ‚ꂤ‚ęB

149 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/06/25(…) 13:36:51
ˆźs–ģ˜Y‚ĶŽč”i‘Ő”jdŽ‹‚Č‚ń‚¶‚į‚Ü‚¢‚©

150 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/06/25(…) 15:27:28
“ļ‚µ‚¢‚Į‚ă}ƒjƒ…ƒAƒ‹“Ē‚ß‚ĪÅŒć‚Ģ—v‘f‚šŽw‚·‚ą‚Ģ‚Ŗ‰½‚©‘‚¢‚Ä‚ ‚é‚ĘŽv‚¤‚Ŗ

151 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/06/25(…) 16:09:13
“Ē‚ń‚Å‚½‚ē‘¼l‚É‚Č‚ń‚©•·‚«‚Ü‚¹‚ńB

152 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/06/25(…) 16:34:16
‚¶‚į‚ Aƒ}ƒjƒ…ƒAƒ‹“Ē‚ń‚Å‚ą‚ķ‚©‚ē‚Č‚©‚Į‚½‚ē‚ØŽčć‚°‚©

153 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/06/29(“ś) 21:37:04
Windows ”Å‚Ģ gawk-3.1.5 ‚Å`‘o•ūŒüƒpƒCƒv‚Ŗ‚¤‚Ü‚­“®ģ‚µ‚Ü‚¹‚ńBˆČ‰ŗA
http://www.kt.rim.or.jp/~kbk/gawk-3.1/gawk.html#SEC182
‚©‚ē‚ĢƒTƒ“ƒvƒ‹ƒtƒ@ƒCƒ‹‚Å‚·‚ŖA“r’†‚ÅŽ~‚Ü‚Į‚Ä‚µ‚Ü‚Į‚āA•ŌŽ–‚Ŗ•Ō‚Į‚Ä‚«‚Ü‚¹‚ńB

BEGIN {
command = "sort"
n = split("abcdefghijklmnopqrstuvwxyz", a, "")

for (i = n; i > 0; i--)
print a[i] |& command
close(command, "to")

while ((command |& getline line) > 0)
print "got", line
close(command)
}

Cygwin ‚Ģ gawk ‚Å‚Ķ–ā‘č‚ ‚č‚Ü‚¹‚ń‚Å‚µ‚½B


154 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/01(‰Ī) 20:42:14
‚±‚źŽg‚¤‚Ę‚¢‚¢‚ę
ttp://www.pipeunish.jp/


155 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/02(…) 01:35:15
‚Ē‚¤‚ā‚Į‚½‚ē Cygwin ‚Ģ gawk(GNU Awk 3.1.6) ‚Å print length("‚ ‚¢‚¤") ‚Ŗ 3 ‚É‚Č‚é‚Ģ‚Å‚·‚©H


156 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/02(…) 02:13:54
Windows‚Ģƒo[ƒWƒ‡ƒ“‚­‚ē‚¢‘‚±‚¤‚ȁB‚Å‚Č‚¢‚Ę’Ž‚č‚ĘŽv‚ķ‚ź‚é‚ę

157 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/02(…) 08:51:57
jgawk?

158 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/02(…) 09:32:16
gawk.dll‚Į‚āA‚Ü‚¾’N‚©ƒƒ“ƒe‚µ‚Ä‚­‚¾‚³‚Į‚Ä‚é‚ń‚Å‚µ‚傤‚©H
ÅV”Ågawk‚Ģdll‚š’T‚µ‚Ä‚é‚ń‚Å‚·‚ŖAŒ©‚Ā‚©‚č‚Ü‚¹‚ńB

‚Ü‚½‚ĶAƒ\[ƒX‚Ģtar.gz‚©‚ēdll‚šģ‚é•ū–@‚ŖŚ‚Į‚Ä‚¢‚éƒy[ƒW‚š
Œä‘¶’m‚Ģ•ū‚Ŗ‚¢‚ē‚Į‚µ‚į‚¢‚Ü‚µ‚½‚ēA‹³‚¦‚Ä‚¢‚½‚¾‚Æ‚é‚ʏ•‚©‚č‚Ü‚·B


159 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/02(…) 10:34:53
‚Č‚É‚š‚¢‚Į‚Ä‚é‚Ģ‚©‚ķ‚©‚ē‚ń
ƒ\[ƒX‚Ģtar.gz‚Į‚ĂȂɁH

160 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/02(…) 10:42:47
http://ftp.gnu.org/gnu/gawk/ ‚©‚ēƒ_ƒEƒ“ƒ[ƒh‚Å‚«‚égawk-*.tar.gz‚Ģ‚±‚Ę‚Å‚·‚ŖBB
source‚©‚ēgawk.exe‚šģ‚Į‚½‚肵‚Č‚¢‚Ģ‚Å‚·‚©HH

dll‚ʏ‘‚¢‚Ä‚¢‚é‚Ģ‚Å‚ķ‚©‚é‚©‚Ę‚ĶŽv‚¢‚Ü‚·‚ŖA
windowsŠĀ‹«‰ŗ‚Å‚Ģ˜b‚Å‚·B•’i‚Ķcygwin‚Åmake‚µ‚½gawk‚šŽg‚Į‚Ä‚¢‚é‚Ģ‚Å‚·‚ŖA
dll‚Ŗ‚ ‚é‚Ę‘¼‚ĢŒ¾Œź‚©‚ēŒÄ‚яo‚µ‚ÄŽg‚¦‚é‚Ģ‚Å•Ö—˜‚©‚ȁ[‚ĘŽv‚Į‚Ä‚Ü‚·B


161 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/02(…) 10:45:49
cygwin‚Ķwin—p‚Ģƒ\[ƒX‚¶‚į‚Č‚¢‚©‚ē
win—p‚Ģƒ\[ƒX‚Ŗ‚¢‚é

162 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/02(…) 11:53:32
>>160
Ģ‚ ‚Į‚½DLL”Å‚ĶģŽŅ‚Ŗ“ĘŽ©‚ɍģ‚Į‚½‚ą‚Ģ‚Ż‚½‚¢‚Å
–{‰Ę‚É”½‰f‚³‚ź‚Ä‚Č‚¢‚©‚ē–{‰Ę‚Ģƒ\[ƒX‚©‚ēDLL‚šģ‚é‚Ģ‚Ķ–³—B
DLL”Å‚Ģƒ\[ƒX‚šŽQl‚É‚µ‚ÄŽ©—Ķ‚ōģ‚é‚©
‚Å‚«‚Č‚¢‚Č‚ēģŽŅ‚ɘA—‚µ‚Ä‹¦—Ķ‚š‹‚߂邵‚©‚Č‚¢B

163 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/02(…) 12:05:07
>>160
Ž©•Ŗ‚ʼnüC‚·‚邵‚©‚Č‚¢‚¾‚ė

164 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/03(–Ų) 02:36:53
(ɁĶ`)@±²ĄĄĄ

165 F155F2008/07/05(“y) 15:47:31
>156
XP [Version 5.1.2600] ‚Å‚Ā

166 F [\{}@{}@{}-] ƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/05(“y) 17:55:22
>>153
‚Ü‚¾Œ©‚Ä‚é‚©?
‘½•Ŗ‚Č‚Ø‚Į‚Ä‚é‚ĘŽv‚¤‚ń‚ŐV‚µ‚¢‚Ģ‚ÅŽŽ‚µ‚Ä‚Ż‚Ä‚­‚č‚āB


167 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/06(“ś) 06:36:13
‚¤‚؁H
ģŽŅ~—Õ‚©

168 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/06(“ś) 07:02:21
‚·‚ń‚Ī‚ē‚·‚”

169 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/20(“ś) 00:40:48
AWK@Žg‚Į‚Ä‚P‚T”NH@‚R‚O”N‘O‚ĢƒR[ƒh‚Ŗ“f‚«o‚·ƒf[ƒ^‚š‚æ‚傱‚Į‚ʏˆ—‚µ‚ꂤ‚Ę‚µ‚āc
FS=/[ ()]+/ ‚ĶŠś‘Ņ’Ź‚č‚Ģ“®‚«‚š‚¹‚øAFS="[ ()]+" ‚ʏ‘‚©‚Ė‚Ī‚Č‚ē‚Č‚¢B
‰‚ß‚Ä’m‚Į‚½B
@ŒŸõ‚µ‚Ä‚ąA‚±‚ź‚É‚Ā‚¢‚Ä–¾‰õ‚ɏ‘‚¢‚Ä‚ ‚éƒy[ƒW‚Ŗ‚Č‚©‚Č‚©Œ©‚Ā‚©‚ē‚Č‚©‚Į‚½‚Ŗ
„³‹K•\Œ»’萔‚Ŗ‚»‚źŽ©g‚Ę‚µ‚ÄŒ»‚ź‚½‚Ę‚«A‚»‚ź‚Ķƒpƒ^[ƒ“’†‚ÉŒ»‚ź‚½‚©‚Ģ‚ꂤ‚ɁA
„‚Ā‚Ü‚č`($0 ~ /foo/)' ‚Ģ‚ꂤ‚É‚Ż‚Č‚³‚ź‚éB
<’†—Ŗ>
„Œ¾Œź‚Ģ‚±‚Ģ‹@”\‚ĶAPOSIX•W€‚܂ŃhƒLƒ…ƒƒ“ƒg‰»‚³‚ź‚Č‚©‚Į‚½B
orz
@‚±‚ź‚Å‚PŽžŠŌ‚®‚ē‚¢ƒ€ƒ_‚É‚µ‚½BŽ„‚Ŗ’m‚ē‚Č‚©‚Į‚½‚¾‚Æ‚Å‚·‚©HH


170 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/20(“ś) 00:58:40
wƒvƒƒOƒ‰ƒ~ƒ“ƒOŒ¾ŒźAWKx‚É‚Ķˆź‰žŚ‚Į‚Ä‚é‚Æ‚Ē‚Č
> iFS‚É‘ć“ü‚³‚ź‚éj•¶Žš—ń‚Ŗ1•¶Žš‚ę‚č’·‚¢‚Ę‚«‚ĶC³‹K•\Œ»‚Ę‚µ‚Ĉµ‚ķ‚ź‚é

171 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/20(“ś) 01:10:48
ƒxƒ‹Œ¤Œn“‚ĢŒ¾Œź‚Ķ‹Lq‚ĢŽ©—R“x‚Ķ‚ ‚é‚Ŗ‹““®‚Ŗ‚Ā‚©‚Ż‚Ć‚ē‚¢

172 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/20(“ś) 02:09:53
>>170
@hh‚ňĶ‚ń‚¾•¶Žš—ń‚Ŗ³‹K•\Œ»‚Ę‚µ‚Ĉµ‚ķ‚ź‚é@‚Ę‚¢‚¤‚±‚Ę‚Ę
@//‚ňĶ‚ń‚¾³‹K•\Œ»’萔‚ŏ‘‚¢‚Ä‚Ķ‚¢‚Æ‚Č‚¢@‚Ę‚¢‚¤‚±‚Ę‚Ķ“Æ‚¶‚Å‚Ķ‚Č‚¢B
ŽĄŪAsplitŠÖ”‚Ģ@‘ę‚Rˆų”‚É—^‚¦‚鐳‹K•\Œ»‚Ķ@‚Ē‚æ‚ē‚Å‚ą“®‚­
@‚Ž‚Ž‚ŽA‚±‚±‚Å‚Ķ($0~/foo/)‚É’u‚«Š·‚¦‚Ä•]‰æ‚³‚ź‚Č‚¢‚ń‚¾c
171‚ĢˆÓŒ©‚Ŗ³‚µ‚¢‚ꂤ‚¾‚Ė@ƒ`ƒƒƒ“ƒ`ƒƒƒ“



173 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/21(ŒŽ) 12:39:44
•””‚Ģƒtƒ@ƒCƒ‹‚Ģ“Ē‚Żž‚Ż‚Į‚Ä‚Å‚«‚Ü‚·‚©H
print ƒtƒ@ƒCƒ‹1‚Ģ$2 ƒtƒ@ƒCƒ‹2‚Ģ$1
‚Ż‚½‚¢‚ČŠ“‚¶‚Å

174 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/21(ŒŽ) 13:06:32
>>173
paste‚ÅŒq‚¢‚¶‚įƒ_ƒ?
Ž„‚Ķ‚ę‚­‚ā‚é‚Æ‚ĒB
‰¼‚Ƀtƒ@ƒCƒ‹1‚Ŗ5ƒJƒ‰ƒ€ŒÅ’č‚Č‚ēA
paste ƒtƒ@ƒCƒ‹1 ƒtƒ@ƒCƒ‹2| awk '{print $2 $6;}'
‚Ä‚ČŠ“‚¶‚ŁB
# ƒJƒ‰ƒ€”‰Ā•Ļ‚Č‚ē‚ą‚¤ˆź”P‚č•K—v‚¾‚Æ‚Ē‚ĖB

175 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/21(ŒŽ) 13:50:02
>>173
awk‚¾‚Æ‚Å‚ā‚č‚½‚¢‚Č‚ēgetline‚šŽg‚¦‚Ī‚Å‚«‚éB

176 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/22(‰Ī) 18:37:52
awk‚·‚²‚¢•Ö—˜‚ŁAgnuplot‚Ę‘g‚Ż‡‚ķ‚¹‚ÄExcel‚©‚ē‰š•ś‚³‚ź‚Ā‚Ā‚ ‚č‚Ü‚·B
ć‚Ģ•ū‚É‚ ‚Į‚½DFA‚ĘNFAŽg‚Į‚Ă鎖‚©‚ē‚­‚éˆį‚¢‚Į‚Ä‚Č‚ń‚Å‚·‚©H


177 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/07/23(…) 02:40:07
>>176

ˆź”Ō‚Ģˆį‚¢‚ĶADFA‚¾‚ĘŒć•ūŽQĘ‚Ŗ‚Å‚«‚Č‚¢‚±‚Ę‚©‚ȁB
‚Ę‚č‚ ‚¦‚ø

DFA
‘O€”õ‚ÉŽčŠŌ‚šŠ|‚Æ‚é‚Æ‚Ēˆ—‚»‚Ģ‚ą‚Ģ‚Ķ‘‚¢

NFA
‘¦Ą‚ɏˆ—‚šŽn‚ß‚é‚Æ‚ĒAˆ—‚ÉŽžŠŌ‚Ŗ‚©‚©‚鏼‡‚Ŗ‚ ‚éB

‚®‚ē‚¢‚ɍl‚¦‚Ä‚Ø‚Æ‚Ī‚¢‚¢‚ĘŽv‚¤B


178 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/08/02(“y) 00:57:57
•ŪŽē

179 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/08/02(“y) 14:34:05
sh + awk ‚Ķ–¾‚ē‚©‚ÉŠČ’P‚¾‚ĘŽv‚¤B
sh + awk ‚ŏo—ˆ‚邱‚Ę‚š perl ‚Ģ‚Ż‚Å‹Lq‚·‚él‚Ģ‹CŽ‚æ‚Ŗ‚Ē‚¤‚µ‚Ä‚ą—‰šo—ˆ‚Č‚¢B
‚½‚¾Aƒlƒbƒgƒ[ƒNƒvƒƒOƒ‰ƒ~ƒ“ƒOˆČć‚É‚Č‚é‚ĘC, perl, ruby ‚É‚Č‚ē‚“‚é‚š“¾‚Č‚¢‚Æ‚ĒB

ƒ}ƒVƒ“’P‘Ģ‚Å‚ĢŽķX‚ĢŽč‘±‚«‹Lq‚¾‚ʁA
sh + awk ‚Ŗ‚ā‚Į‚Ļ‚čˆź”ŌŠ®Œ‹‚É‚Č‚é‚ĘŽv‚¤‚ń‚¾‚Æ‚Ē‚ȁ`B

180 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/08/02(“y) 14:49:58
‚Ø‚ź‚ąawk‚Å‚Å‚«‚邱‚Ę‚Č‚ēawk‚Å‚ā‚éB
‚Å‚ą‚ ‚Ü‚č‚ɃgƒŠƒbƒL[‚Č‚±‚Ę‚É‚Č‚č‚»‚¤‚¾‚Į‚½‚ēperl‚Å‚ā‚Į‚½‚č‚·‚é‚©‚ȁB


181 F‚ ‚¢‚æ‚į‚ńF2008/08/03(“ś) 01:39:18
l‚É“n‚·‰Ā”\«‚Ŗ‚ ‚é‚Č‚ēAawk‚ĶŒ‹\‚Ā‚ē‚¢‚±‚Ę‚Ŗ‚ ‚éB
Perl‚Å‚ā‚ź‚ĪŠī–{“I‚É–ā‘č‚Č‚¢‚©‚ēAPerl‚ŏ‘‚­•Č‚Ŗ‚Ā‚­B
ShellScript‚Å‚¢‚Į‚½‚ńŽg‚¤‚¾‚Æ‚Č‚ēAawk‚Ķ•Ö—˜‚¾‚Æ‚ĒB

182 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/08/04(ŒŽ) 01:23:58
>>180
‰“‚ą@AWK ‚Å‚Å‚«‚é‚Č‚ēAWKB
‚ʍl‚¦‚é‚ʁ@ƒoƒCƒiƒŠ[‚Ģƒf[ƒ^‚¢‚¶‚éˆČŠO‚ĶAWK‚Å‚Å‚«‚é‚Ģ‚Å‚Ķc
i­‚Č‚­‚Ę‚ą@‰“‚É“śķ‚Ģƒj[ƒd‚Å‚Ķ@‚»‚¤‚¾j

183 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/08/04(ŒŽ) 02:16:24
>>182
“ÆŠ“B‚½‚¾ƒoƒCƒiƒŠ‚ĶŽd•ū‚Č‚¢‚É‚µ‚Ä‚ąA
‘S”¼Šp¬Ż‚ĢŒÅ’č’·ƒtƒH[ƒ}ƒbƒg‚Ŗˆµ‚¢‚É‚­‚¢‚ń‚¾‚ę‚ȁB
ASCII‚É‚·‚é‚Ę‘SŠp‚Ģ‚Ż•”•Ŗ‚Ŗˆ—‚µ‚É‚­‚¢‚µA
SJIS‚Ę‚©‚É‚·‚é‚ʐ³‚µ‚­Ų‚čo‚¹‚Č‚¢‚µ„„„
‚ ‚ź‚Ķ‚Č‚ń‚Ę‚©‚Č‚ē‚ń‚ą‚Ģ‚©‚ȁB

184 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/08/07(–Ų) 01:55:09
‚ā‚Į‚Ļ‚č ASCII ‚¾‚Æ‚Ģ–ā‘č‚É‚µ‚Ä‚Ø‚¢‚½•ū‚Ŗ–³“ļB

185 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/08/11(ŒŽ) 15:38:13
ttp://www.kt.rim.or.jp/~kbk/gawk-3.1/
‚Ń_ƒEƒ\‚Å‚«‚é‚Ģ‚ŖASCII‚ĘSJIS‚š‚¤‚Ü‚­ˆµ‚¦‚é‚ā‚Ā‚Ą‚į‚Ė‚ĢH

186 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/08/13(…) 00:38:23
>>185
‚¢‚āA‚»‚ĢgawkŽg‚Į‚Ä‚é‚Æ‚ĒA‘S”¼Šp¬Ż‚ĢŒÅ’č’·‚Ķ¢‚é‚Ķ‚øB
—¼•ū•ŹX‚Č‚ē–ā‘č‚Č‚­ˆµ‚¦‚é‚Æ‚ĒA“ÆŽž‚É‚Ķˆµ‚¦‚Č‚¢B
—į‚¦‚ĪBSJIS‚Ps5ƒoƒCƒg+‰üs‚ĢŒÅ’č’·ƒtƒ@ƒCƒ‹‚Å
‚Ps‚Ķ‚Q€–Śia:‘S”¼Šp¬Ż4ƒoƒCƒg b:”¼Šp‚Ģ‚Ż1ƒoƒCƒgj‚Ģƒtƒ@ƒCƒ‹‚Ŗ‚ ‚é‚Ę‚«B
asciiƒ‚[ƒh‚Č‚ēa, b‚šŲ‚č•Ŗ‚Æ‚ē‚ź‚é‚Ŗa‚Ģ‘SŠp•¶Žš‚Ķˆ—‚Å‚«‚Č‚¢B
sjisƒ‚[ƒh‚Č‚ēa, b‚šŲ‚č•Ŗ‚Æ‚ē‚ź‚Č‚¢B

”Y‚Ü‚µ‚¢‚Ģ‚ĶA€–Ś‚šŲ‚č•Ŗ‚Æ‚éƒXƒNƒŠƒvƒg‚šascii ƒIƒvƒVƒ‡ƒ“‚Å‹N“®‚µ‚Ä
o—ĶŒ‹‰Ź‚šsjis‚ŏˆ—‚·‚ź‚Īi‚ß‚ń‚Ē‚­‚³‚¢‚Æ‚ĒjŒ»ó‚ŏˆ—‚Å‚«‚Ä‚µ‚Ü‚¤B
‚Ģ‚ŁAƒ}ƒjƒ…ƒAƒ‹‚ɏ‘‚¢‚Ä‚ ‚é’Ź‚čAģŽŅ‚š‚Ø‚Ė‚Ŗ‚¢‚·‚ź‚Ī‰Ā”\«‚Ķ‚ ‚é‚©‚ą‚µ‚ź‚Č‚¢‚ŖA
‚ØŠč‚¢‚·‚é‚Ģ‚ŖēSēO‚ķ‚ź‚銓‚¶‚Č‚Ģ‚ĖB


187 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/08/13(…) 22:12:09
awk‚ĶŽž‘ć‚ĢŠÖ”‚¾‚©‚ēŽg‚ķ‚ź‚Č‚­‚Č‚Į‚Ä‚¢‚­‚ń‚¾‚ė‚Č‚ 

188 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/08/15(‹ą) 02:08:00
UTF-8‚Ģź‡‚Å‚ąŒÅ’č’·‚Ķ”¼Šp•‚µ‚©‘Ī‰ž‚Å‚«‚Ä‚Č‚¢B
•¶Žš”‚ĘƒoƒCƒg”‚Ę•\Ž¦•‚Ę‚©A“ś–{Œź‚Ķ–Ź“|‚¾‚Ģ‚¤B

length()‚Ę‚©‚ŃoƒCƒg”‚šE‚¦‚Č‚¢‚©‚ēŽ©‘O‚ŏˆ—‚ą‚ā‚č‚É‚­‚¢B

189 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/08/19(‰Ī) 22:37:59
>>188
ˆźu”[“¾‚µ‚©‚Æ‚½‚Æ‚ĒB
—āĆ‚ɍl‚¦‚é‚ʁA‚»‚ą‚»‚ą‚P•¶Žš‚Ŗ‰Ā•Ļ’·‚Å‚ ‚éUTF8‚š
ŒÅ’č’·ƒtƒ@ƒCƒ‹‚Ģ•¶ŽšƒR[ƒh‚ÉŽg‚Ø‚¤‚ʍl‚¦‚½“z‚š’÷‚ßć‚°‚Ä
‹ƒ‚­‚Ł‚Ē–ā‚¢‹l‚ß‚é•ū‚Ŗę‚¾‚ĘŽv‚¤‚Ģ‚Ķ‰“‚¾‚ƁH

l‚¦‚Ä‚ąl‚¦‚Ä‚ąƒƒŠƒbƒg‚ŖŽv‚¢‚Ā‚©‚Č‚¢‚ęc

190 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/08/21(–Ų) 00:40:10
>>189
‚Ł‚Ę‚ń‚Ē‚Ģ•¶ŽšƒR[ƒh‚Ŗ‰Ā•Ļ’·‚¾‚©‚ē‚Č‚ B
‘Š‘Ī“I‚ÉŒ©‚ź‚Īƒ}ƒV‚Č•ū‚É“ü‚é‚ń‚¶‚į‚Č‚¢?
ƒzƒXƒg‚Ŗ—‚Ž‚Ę•¶ŽšƒR[ƒhŽü‚č‚Ķ”ߎS‚¾‚ęc
ƒzƒXƒg‚¶‚į‚Č‚¢‚Č‚ē‚»‚ą‚»‚ąŒÅ’č’·‚¶‚į‚Č‚­‚Ä—Ē‚¢‚ń‚¾‚Æ‚Ē‚ĖB

191 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/08/23(“y) 01:53:25
‚ ‚éƒtƒBƒ‹ƒ^ƒXƒNƒŠƒvƒg‚šgawk‚ŏ‘‚¢‚Ä‚¢‚é‚Ģ‚Å‚·‚Ŗ
•¶Žš‚ĢƒR[ƒh‚š®”’l‚É•ĻŠ·‚µ‚ꂤ‚Ę‚µ‚Ä‚¤‚Ü‚­‚¢‚«‚Ü‚¹‚ń
‚½‚Ę‚¦‚Īucv‚Ę‚¢‚¤•¶Žš‚ĢƒR[ƒh‚š®”’l‚É‚µ‚ꂤ‚Ę‚µ‚Ä
BEGIN {
@testChar = "c";
@printf("testChar=%d\n",testChar);
}
‚Ģ‚ꂤ‚É‚µ‚Ä‚ąutestChar=0v‚Ę•\Ž¦‚³‚ź‚Ä‚µ‚Ü‚¢‚Ü‚·
—Ē‚¢•ū–@‚Ŗ‚ ‚ź‚Ī‚Ø‹³‚¦‚­‚¾‚³‚¢

192 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/08/23(“y) 03:21:15
>>191

awklib ‚É ord ‚Į‚ㆁ[ƒU[’č‹`‚Ģƒ‰ƒCƒuƒ‰ƒŠŠÖ”‚Ŗ‚ ‚é‚©‚ē‚»‚ź‚šŽg‚¤B
Ž©‘O‚ōģ‚Į‚Ä‚ą‚¢‚¢‚Æ‚Ē‚ĖB

‚­‚ķ‚µ‚­‚Ķ info gawk ‚Å’²‚ׂāB


193 F191F2008/08/23(“y) 03:28:08
>>192
‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·
‘‘¬ŒŸ“¢‚µ‚Ä‚Ż‚Ü‚·

194 F191F2008/08/23(“y) 10:56:41
>>192
ttp://www.kt.rim.or.jp/~kbk/gawk-30/gawk_16.html
‚É‚ ‚Į‚½‚ą‚Ģ‚šŽŽ‚µ‚Ä‚Ż‚Ü‚µ‚½.Šś‘Ņ‚Ē‚Ø‚č‚Ģ“®ģ‚š‚µ‚Ä‚­‚ź‚Ü‚·.
‚Ē‚¤‚ą‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚µ‚½.

195 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/09/15(ŒŽ) 01:12:37
“ü—Ķ“ą—e‚šawk‚Ő¶¬‚·‚邱‚Ę‚Ķo—ˆ‚Ü‚·‚Å‚µ‚傤‚©
‚ą‚µ‚­‚ĶBEGIN“™‚ĢƒuƒƒbƒN“ą‚Å•¶Žš—ń‚š¶¬‚µ‚Ä
‚»‚Ģ•¶Žš—ń‚Ģƒpƒ^[ƒ“–ˆ‚É•ŖŠņAƒtƒB[ƒ‹ƒh‚šŽg‚Į‚Ä‚Ģˆ—
i—v‚Ķawk‚É“ü—Ķƒtƒ@ƒCƒ‹“n‚µ‚½Žž‚ÉŠČ’P‚ɏ‘‚Ƃ鏈—j
‚šŠČ’P‚ɏ‘‚­‚±‚Ę‚Ķo—ˆ‚é‚Ģ‚Å‚µ‚傤‚©

—į‚¦‚Īc‚Ē‚ń‚ȏˆ—‚Ŗ“KŲ‚Ȑą–¾‚©”»‚č‚Ü‚¹‚ń‚Ŗ
BEGIN{for(i=0;i<10;i++) print int(rand()*10),int(rand()*10),int(rand()*10)}
‚ĢŒ‹‰Ź‚É‘Ī‚µ‚Ä
$1+$2+$3<10{ print $1+$2+$3 }
$1+$2+$3>=10{ print ($1+$2+$3) % 10 }
c‚Ę‚©‚»‚ń‚ČŠ“‚¶‚ŁAƒeƒLƒXƒg‚š¶¬‚µ‚½Œ‹‰Ź‚É‘Ī‚µ‚Ä
ƒtƒBƒ‹ƒ^[‚Ę‚µ‚Ä”äŠrŽ®‚ā³‹K•\Œ»‚Å•ŖŠņ‚µ‚āAƒtƒB[ƒ‹ƒh‚šŽg‚Į‚ďˆ—‚·‚銓‚¶‚Å‚·B

‚ā‚Į‚Ļ‚čƒoƒbƒ`ƒtƒ@ƒCƒ‹‚Ęawkƒtƒ@ƒCƒ‹‚š‚¢‚­‚Ā‚ąģ‚Į‚½‚č
ˆźsˆźs‚É‘Ī‚µ‚Äif•¶‚Å•ŖŠņ‚µ‚½‚čsplit‚Å•ŖŠ„‚·‚邵‚©–³‚¢‚Å‚·‚©‚ĖcB

196 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/09/15(ŒŽ) 01:52:51
>>195
Šø‚¦‚Ä“ü—Ķ‚š¶¬‚µ‚½‚¢‚Ģ‚Č‚ēAawk‚šƒpƒCƒv‚ÅŒq‚°‚Ī‚¢‚¢‚ĘŽv‚¤B
‚»‚¤‚Å‚Ķ‚Č‚­A’P‚É—”‚ŏˆ—‚šU‚č•Ŗ‚Æ‚½‚¢‚Ģ‚Č‚ē•’Ź‚Éif•¶‚Å‚¢‚¢‚ĘŽv‚¤B

‚»‚ź‚Ķ‚³‚Ä‚Ø‚«A
--
$1+$2+$3<10{ print $1+$2+$3 }
$1+$2+$3>=10{ print ($1+$2+$3) % 10 }
--
‚Ķ•Ź‚ɏć‚ĢšŒŽ®‚Ķ—v‚ē‚ń‚¾‚ėBˆźŒ…‚Ģ”’l‚š10‚ÅŠ„‚Į‚½—]‚č‚ĶŒ³‚Ģ‚Ü‚Ü‚¾‚©‚ē‚ȁB

197 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/09/15(ŒŽ) 14:18:55
>196
‚¢‚ā‚ ‚­‚Ü‚Å—į‘č‚Č‚Ģ‚Å“ą—e‚Ķ[‚­l‚¦‚Č‚¢‚Å‚­‚¾‚³‚¢corz

•’Ź‚Éif•¶‚Ę‚ĶŒ¾‚¤‚ą‚Ģ‚ĢAÜŠpawk‚Ŗ•W€‚Å”õ‚¦‚Ä‚é•Ö—˜‚Č‹@”\‚š–³Ž‹‚µ‚ďē’·‚ȏ‘‚«•ū‚·‚é‚Ģ‚ą“ļ‚¾‚µ
‚©‚ĘŒ¾‚Į‚Ä.awkƒtƒ@ƒCƒ‹•””ŒĀ‚Ęƒoƒbƒ`‚ŁAƒpƒCƒv‚Å‚Ā‚Č‚°‚ďˆ—‚·‚é‚Ģ‚ąc‚¤`‚ńA‚Ę‚Č‚Į‚Ä‚µ‚Ü‚¤B
—Ē‚¢‘‚«•ū–³‚¢‚©‚Č‚Ÿ‚ĘŽv‚Į‚½‚Ģ‚Å•·‚¢‚Ä‚Ż‚½‚Ģ‚Å‚·‚ŖAif‚Ęsplit‚ÅŠę’£‚č‚Ü‚·B

198 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/09/16(‰Ī) 02:58:54
Žæ–ā‚Ŗ‚ę‚­‚ķ‚©‚ē‚ń‚Ģ‚¾‚ŖABEGIN•”‚Ő¶¬‚µ‚½ƒtƒ@ƒCƒ‹‚šˆ—•”‚ňµ‚¢‚½‚¢‚Ę‚¢‚¤‚±‚Ę‚©‚ȁH
—į‚¦‚ĪA
gawk 'BEGIN{ ARGV[1]="in_file.txt"; ARGC=2; }{ print }'
‚Į‚Ä‚ā‚Į‚½‚ē in_file.txt ‚š•\Ž¦‚Å‚«‚邼‚¢

199 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/09/16(‰Ī) 09:51:03
>198
III
–Ś‚©‚ē—Ų‚Å‚·B

‚»‚Į‚©Aƒtƒ@ƒCƒ‹¶¬‚µ‚æ‚į‚¦‚Īˆź”­‚ōs‚Æ‚é‚Ģ‚©c‚ā‚Į‚Ä‚Ż‚Ü‚·

200 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/09/16(‰Ī) 15:07:48
‚¤‚°Aˆź’Uƒtƒ@ƒCƒ‹‚šģ‚é‚Ģ‚Ķ‚ ‚č‚Č‚Ģ‚©‚ęB
if‚šŽg‚¤‚Ģ‚Ķē’·‚Č‚Ģ‚ɁAƒtƒ@ƒCƒ‹‚šģ‚é‚Ģ‚Ķē’·‚¶‚į‚Č‚¢‚Į‚Ä‚Ē‚ń‚ČƒZƒ“ƒX‚Č‚ń‚¾B

201 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/09/16(‰Ī) 17:48:16
>200
“ü—Ķƒf[ƒ^‚Ķ‹K‘„«‚Ģ‚ ‚é‚ą‚Ģ‚ŁA¶¬‚µ‚Ä‚µ‚Ü‚¦‚é‚Æ‚Ē
‚»‚ź‚É‘Ī‚µ‚Ä‚Ģ•ŖŠņ‚Ķ‘½‚¢c‚Ę‚¢‚¤ź‡
if‚āsplit‚š—…—ń‚·‚é‚ę‚č‚ąAawk‚ŖŒ³XŽ‚Į‚Ä‚é
ƒpƒ^[ƒ“‚ĘƒtƒB[ƒ‹ƒh•ŖŠ„‚šŽg‚Į‚½•ū‚Ŗ
ƒXƒbƒLƒŠ‚·‚é‚ĘŽv‚¤‚Ģ‚Å‚·‚ŖŠŌˆį‚Į‚Ä‚é‚Å‚µ‚傤‚©cB

202 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/09/16(‰Ī) 19:39:26
>>201
•Ź‚É‚¢‚¢‚ń‚¶‚į‚Ė?
‹‘å‚Č’†ŠŌƒtƒ@ƒCƒ‹‚šģ‚é‚Į‚Ä‚ķ‚Æ‚Å‚ą‚Č‚¢‚ń‚¾‚ė‚¤‚µB
‚Ü‚ŸAŽŸ‚Ģ——R‚ÅŽ„‚Ķ’†ŠŌƒtƒ@ƒCƒ‹‚šģ‚é‚Ģ‚Ķ”š‚Æ‚é‚Æ‚Ē‚ĖB
Eƒtƒ‹ƒpƒX‚šŽw’肵‚Č‚¢ź‡AƒJƒŒƒ“ƒgƒfƒBƒŒƒNƒgƒŠ‚ɏ‘‚«ž‚ŻŒ ŒĄ‚Ŗ‚ ‚é•Ūį‚Ŗ‚Č‚¢B
E‚»‚ą‚»‚ą“Æ–¼ƒtƒ@ƒCƒ‹‚Ŗ‘¶Ż‚µ‚Ä‚¢‚ď‘‚«ž‚ŻŒ ŒĄ‚Ŗ‚Č‚¢‚©‚ą’m‚ź‚Č‚¢B
E‚Ā[‚©A“ÆŽž‚É2Œ“®‚©‚µ‚½‚ēƒoƒbƒeƒBƒ“ƒO‚µ‚Ä‚µ‚Ü‚¤B
E‚¾‚©‚ē‚ĘŒ¾‚Į‚āAˆźXƒ†ƒj[ƒN‚Č–¼‘O‚Ģƒtƒ@ƒCƒ‹–¼‚š¶¬‚·‚é‚Ģ‚ą–Ź“|‚¾B
E‚µ‚©‚ąA’†ŠŌƒtƒ@ƒCƒ‹‚ĶŒć‚ŏĮ‚µ‚Ä‚Ø‚­•K—v‚Ŗ‚ ‚é‚©‚ą‚µ‚ź‚Č‚¢B

‚»‚ź‚ʁAŽ©‘O‚Å“ü—Ķ‚š¶¬‚·‚é‚Č‚ēAÅ‰‚©‚ē•ŖŠ„‚³‚ź‚½ó‘Ō‚ōģ‚ź‚Ī‚¢‚¢‚©‚ēsplit‚Ķ—v‚ē‚Č‚¢‚ĖB
ƒpƒ^[ƒ“‚šŽg‚¤‚©if‚šŽg‚¤‚©‚ĶŽļ–”‚Ģ–ā‘č‚Ģ‚ꂤ‚Č‹C‚Ŗ‚·‚é‚Æ‚ĒB
# $1+$2+$3<10{print;}‚ʏ‘‚­‚©if($1+$2+$3<10){print;}‚ʏ‘‚­‚©‚Ģˆį‚¢‚¾‚ą‚ń‚ĖB

203 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/09/18(–Ų) 01:19:00
FXl‚¦•ū‚Ŗ‚ ‚é‚Ģ‚ĖB

Ž©•Ŗ‚Č‚ēƒgƒŠƒbƒL[‚ȍ׍H‚µ‚Ä‚P‚Ā‚ÉŽū‚ß‚ø•ŖŠ„‚µ‚ÄifŽg‚ķ‚ø‚ɏ‘‚­‚Æ‚ĒB
Žč‘‚­ƒJƒ^‚š‚Ā‚Æ‚ē‚ź‚é‚Ģ‚Ŗawk‚Ģ—Ē‚¢Š‚¾‚ĘŽv‚¤‚µA
‹ZI‚É‘–‚é‚ĘŠŌˆį‚¢‚Č‚­–Y‚ź‚é‚Ģ‚сƒ“ƒe•s‰Ā”\‚É‚Č‚é‰Ā”\«‘å

‚܁A‚»‚ź‚Ķ‚»‚ź‚Ę‚µ‚Ä>>198‚ĶƒpƒYƒ‹“I‚Č–Ź”’‚³‚Ŗ‚ ‚Į‚Ä—Ē‚¢‚ĖB


204 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/09/19(‹ą) 19:54:42
>202
‚¤`‚ńAŒ¾‚ķ‚ź‚Ä‚Ż‚ź‚Ī‚»‚¤‚©‚ąB
ˆź‰žA”‰ń‚Ģ‚ĶŽdŽ–‚ÅŽg‚¤‚ķ‚Æ‚Å‚ą‚Č‚Æ‚ź‚Ī‘¼l‚ÉŽg‚Į‚Ä‚ą‚ē‚¤—\’č‚ą‚Č‚¢
Š®‘S‚ČŒĀl—pƒXƒNƒŠƒvƒg‚Č‚Ģ‚Å‚Ē‚¤‚É‚Å‚ą‚Č‚č‚Ü‚·‚Ŗ
‚±‚ź‚Ŗ‹Ę–±‚āŽ©•ŖˆČŠO‚ąŽg‚¤‚ą‚Ģ‚Å‚ ‚ź‚Ī‘f’¼‚Éif‚Č‚ń‚Å‚µ‚傤‚ĖB

205 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/09/22(ŒŽ) 20:50:40
2008/09/15 13:17 61 20080915142145.txt
2008/09/16 13:17 316 2008091611529.txt
2008/09/22 20:09 24,028 2008_0922asahiindex.txt
2008/09/22 12:57 1,545 clean.txt

‚Ę‚¢‚¤ƒtƒ@ƒCƒ‹ˆź——‚©‚ēAgawk‚ō”“ś‚Ģ“ś•t‚Ģƒtƒ@ƒCƒ‹‚¾‚Æ”²‚«o‚·‚É‚Ķ‚Ē‚¤‚·‚č‚į‚¢‚¢‚ń‚¾‚Į‚Æ?

BEGIN{month = strftime("%m",systime()); date = strftime("%d",systime())}

/month/ && /date/ {print $0}

‚Å‚¢‚¢‚©‚ĘŽv‚Į‚½‚ēA/ /‚Ģ‚Č‚©‚Émonth‚Ę‚©‚ĶŽg‚¦‚Č‚¢‚ē‚µ‚¢B

/strftime("%d",systime())/ {print $0}
‚ʂׂ½‘‚«‚µ‚Ä‚ą‚¾‚߁B
‚Ē–Y‚ź’†Bƒwƒ‹ƒvƒ~[B


206 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/09/22(ŒŽ) 21:05:13
BEGIN{date=strftime("%m/%d")} $0 ~ date {print $0}

207 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/09/22(ŒŽ) 21:45:34
>>206
thanks!

208 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/10/10(‹ą) 19:41:51
Žæ–ā‚Å‚·B
“ü—Ķ’†‚Ģƒtƒ@ƒCƒ‹–¼‚ĶFILENAME‚ɃZƒbƒg‚³‚ź‚Ü‚·‚ŖA
“ü—Ķ’†‚Ģƒtƒ@ƒCƒ‹‚ĢƒpƒX‚šŽę“¾‚·‚é‚É‚Ķ‚Ē‚¤‚µ‚½‚ē‚ę‚¢‚Å‚·‚©B


209 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/10/10(‹ą) 22:13:43
>>208
FILENAME‚Å“¾‚ē‚ź‚éī•ń‚Ŗ‘S‚āBƒtƒ‹ƒpƒX‚Ŗ—~‚µ‚¢‚Ę‚¢‚¤‚±‚Ę‚Č‚ēA
cwd‚šŽę“¾‚µ‚Ä‚»‚±‚©‚ē‚Ģ‘Š‘ĪƒpƒX‚ŖFILENAMEB

210 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/12(…) 19:19:08

awk‚ĢŒ‹‰Ź‚š set ‚©@setenv ‚Ģ•Ļ”‚É‘ć“ü‚µ‚½‚¢‚Å‚·B

awk '{ print $1+ $3 }' test.txt
‚Ő”’l‚Ŗo‚Ü‚·B
‚±‚ĢŒ‹‰Ź‚š•Ļ”‚É‘ć“ü‚·‚é‚É‚Ķ‚Ē‚¤‚µ‚½‚ē‚¢‚¢‚ń‚Å‚µ‚傤‚©H

set tmp=`awk '{ $1+ $3 }' test.txt`

‚±‚ź‚¾‚ʏćŽč‚­‚¢‚«‚Ü‚¹‚ńBprint ‚Ķ‚»‚Ģ‚Ü‚Ü‚Å‚¢‚¢‚Ģ‚Å‚µ‚傤‚©H

211 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/12(…) 20:24:22
‚Č‚ń‚Å print ‚šČ—Ŗ‚Å‚«‚é‚ʍl‚¦‚½‚Ģ‚©‚Ŗ“䂾‚Ŗ

212 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/12(…) 23:57:16
>print ‚Ķ‚»‚Ģ‚Ü‚Ü‚Å‚¢‚¢‚Ģ‚Å‚µ‚傤‚©H
‚Ü‚øŽŽ‚¹‚ę‚—

213 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/13(–Ų) 14:17:14
V‹IŒ³ŽŠ‚ĢƒvƒƒOƒ‰ƒ~ƒ“ƒOŒ¾Œźawk‚Ŗ‚Ē‚±‚ą”„‚čŲ‚ź‚Č‚ń‚¾‚Æ‚Ē
‚ą‚¤“ü‚ē‚Č‚¢‚Ģ‚©‚Č

214 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/16(“ś) 03:02:56
>>211
print‚Ķ‰ę–Ź•\Ž¦‚·‚é‚ą‚ĢØ•Ļ”‚É“ü‚ź‚邾‚Æ‚Č‚ē•s—v
c‚ĘŽv‚Į‚½‚ń‚¶‚į“ą‰Č‚Ė

215 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/18(‰Ī) 11:28:33
ƒJƒ“ƒ}‹ęŲ‚č‚Ģƒf[ƒ^ƒtƒ@ƒCƒ‹‚Ŗ‚ ‚čA‚»‚Ģ’†‚ŁA‘ę‚PƒtƒB[ƒ‹ƒh‚Ę‘ę‚RƒtƒB[ƒ‹ƒh“ą‚É‚ą‚µ
Žq‰¹AŽq‰¹AŽq‰¹A•ź‰¹‚Ŗ‘¶Ż‚·‚ź‚Ī‚»‚Ģs‚¾‚Æ”²‚«o‚·ƒI[ƒN‚ĢƒXƒNƒŠƒvƒgƒtƒ@ƒCƒ‹‚š‚Ā‚­‚č‚½‚¢‚Ģ‚Å‚·‚Ŗ‚Ē‚¤‚·‚ź‚Ī‚ę‚¢‚Å‚·‚©

216 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/18(‰Ī) 11:41:15
>>215
ƒf[ƒ^ƒtƒ@ƒCƒ‹‚ĢƒTƒ“ƒvƒ‹‚Ę”²‚«o‚µ‚½‚¢sƒˆƒ

217 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/18(‰Ī) 11:50:40
‚±‚ń‚ČŠ“‚¶‚Å‚·
takeshi,fiad,fdjioaf,fdjsoafdsi©ŠY“–‚Č‚µj
dddacea,fsaofsa,rrra,fjisaofdjsaiddda‚Ęrrra‚ŖŠY“–j
aexxxu,dsoifsa,yyyuo,fjsaofaixxxu‚Ęyyyu‚ŖŠY“–j

218 F‚Ń‚¬‚Č‚ŸF2008/11/18(‰Ī) 12:12:55
ƒI[ƒNƒXƒNƒŠƒvƒg‚šŽĄs‚·‚é‚ʏī•ń‚š•\Ž¦‚·‚é‚ꂤ‚É‚µ‚½‚Ģ‚Å‚·‚Ŗ‚Ps–Ś‚ĘÅŒć‚Ģs‚¾‚Æ‚š•\Ž¦‚µ‚Č‚¢‚ꂤ‚É‚·‚é‚É‚Ķ
END“ą‚ɉ½‚ď‘‚Æ‚Ī‹X‚µ‚¢‚Å‚µ‚傤‚©

219 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/18(‰Ī) 12:43:59
>>215
BEGIN{FS=","}
function term_check(term, lower_term) # lower_term ‚Ķ‹ĒŠ•Ļ”
{
lower_term=tolower(term)
if(lower_term ~ /[bcdfghjklmnpqrstvwxyz][bcdfghjklmnpqrstvwxyz][bcdfghjklmnpqrstvwxyz][aiueo]/) return 1
return 0
}
{
if(term_check($1) && term_check($3)) print
}

ƒpƒ^[ƒ“ŒJ‚č•Ō‚µ‚Į‚Ä {3} ‚Ę‚©‚Å‚¢‚Æ‚é‚Ķ‚ø‚Č‚ń‚¾‚Ŗ
‘‚«•ū’m‚ē‚Č‚¢‚Ģ‚ŃRƒsƒy‚µ‚½‚—

220 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/18(‰Ī) 12:47:37
>>218
’€ŽŸo—Ķ‚µ‚Ä‚éH
END ‚Å‚Ü‚Ę‚ß‚Äo—Ķ‚µ‚Ä‚éH

221 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/18(‰Ī) 13:53:22
>>218
1s‚ø‚Āƒoƒbƒtƒ@ƒŠƒ“ƒO‚µ‚āAŽŸ‚Ģs‚Ģ“ü—Ķ‚Å‘O‚Ģs‚šo—Ķ‚·‚ź‚ĪÅŒć‚Ģs‚ĶĮ‚¦‚Ä‚Č‚­‚Č‚éB
awk 'NR > 2 {print buffer;} NR > 1 {buffer = $0;}'

222 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/18(‰Ī) 14:20:29
>>215
gawk‚Č‚ē
awk -F "," -v r="[bcdfghj-np-tv-z]{3}[aiueo]" --posix '$1 ~ r && $3 ~ r'
$1‚Ę$3‚Ē‚æ‚ē‚©ˆź•ū‚É‚ ‚ź‚Ī‚¢‚¢‚Č‚ē&&‚š||‚É•Ļ‚¦‚Ä‚Ė

223 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/18(‰Ī) 16:29:37
>>219
•‚©‚č‚Ü‚µ‚½I

224 F‚Ń‚¬‚Č‚ŸF2008/11/18(‰Ī) 16:46:03
o—ˆ‚Ü‚µ‚½@‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·

225 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/19(…) 23:48:41
ž‚Ż“ü‚Į‚ĂĐ®—‚Å‚«‚Č‚¢‚Ģ‚Å‹³‚¦‚Ä‚­‚¾‚³‚¢B
E‘ĪŪ‚ĢƒeƒLƒXƒg‚Ķ2s–Ś‚Ŗ‚Č‚¢(1s–Ś‚µ‚©‚Č‚¢)‚©‚Ā
E1s–Ś‚Ķ‚Š‚ē‚Ŗ‚ČƒJƒ^ƒJƒiŠæŽš‚Å15•¶ŽšˆČ“ą
‚Ę‚¢‚¤šŒ‚š‘‚­‚Ģ‚Į‚āAŽŸ‚Ģ‚ꂤ‚É‚µ‚½‚Ģ‚Å‚·‚ŖA‚¤‚Ü‚­ƒqƒbƒg‚µ‚Ü‚¹‚ńB
‚Ē‚¤‘‚Æ‚Ī‚¢‚¢‚Å‚µ‚傤?

NR==2 && length($0) == 0 && NR==1 && /[‚Ÿ-‚ńƒ@-ƒ–ˆŸ-˜r]{1,15}/


226 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/19(…) 23:53:31
>>225
NR == 2 && NR == 1‚¶‚įAā‘Ī¬—§‚µ‚Č‚¢‚¾‚ėB

227 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/19(…) 23:54:54
awk‚Ķs‚š1s‚ø‚Āˆ—‚·‚é‚©‚ēAŽ–‘O‚Ƀg[ƒ^ƒ‹s”‚š’m‚邱‚Ę‚Ķ‚Å‚«‚Č‚¢B
ƒg[ƒ^ƒ‹s”‚Ŗ1s‚Å‚ ‚邱‚Ę‚š•ŪŲ‚µ‚½‚¢‚Č‚ēAENDƒuƒƒbƒN‚ŏˆ—‚·‚邵‚©‚Č‚¢B

228 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/20(–Ų) 00:22:37
>Ž–‘O‚Ƀg[ƒ^ƒ‹s”‚š’m‚邱‚Ę‚Ķ‚Å‚«‚Č‚¢
BEGIN•”‚Ő”‚¦‚ź‚ĪH

229 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/20(–Ų) 00:28:19
>>228
‚Ē‚¤‚ā‚Į‚Ä? ‘ĪŪ‚Ŗƒtƒ@ƒCƒ‹‚Å‚ ‚é•ŪŲ‚Ŗ‚ ‚é‚Č‚ēwc‚Å‚ąŒÄ‚ׂĪ‚¢‚¢‚Æ‚Ē‚»‚ź‚Č‚ēawk‚Å‚ā‚é•K—v‚³‚¦‚Č‚¢‚ę‚ĖB

230 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/20(–Ų) 03:49:07
{ a = $0 }
END { if (NR == 1 && a ~ /re/) print a }
‚Ę‚©?

231 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/20(–Ų) 23:58:06
‚Ē‚Č‚½‚©A”CˆÓƒrƒbƒg•‚Ģ2‚Ģ•ā”HEX‚šDEC‚É•ĻŠ·‚·‚éƒvƒƒOƒ‰ƒ€‚š‘‚¢‚Ä‚ą‚ē‚¦‚Ü‚¹‚Ź‚©H

232 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/22(“y) 12:02:58
Žd—l‚Ŗ•s–¾Šm‚Č‚Ę‚±‚ė‚Ŗ‚ ‚邵A‚Č‚É‚ę‚č‚Č‚ń‚Åawk‚Å?


233 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/26(…) 22:53:51
>>232
‚±‚±‚ŖawkƒXƒŒ‚¾‚©‚ē‚Å‚µ‚åB

234 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/11/29(“y) 03:05:38
>>232
l‚¦‚é‚ȁBŠ“‚¶‚ė‚—

235 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/12/12(‹ą) 07:21:00
u‚ ‚Č‚½‚Ķ‰½ŒĢawk‚Å‚ā‚ė‚¤‚Ę‚·‚é‚Ģ‚Å‚·‚©Hv
u‚»‚±‚Éawk‚Ŗ‚ ‚é‚©‚ēv

236 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/12/13(“y) 04:23:45
awk‚©‚ēsystem()‚Ågrep‚Ę‚©sed‚Ę‚©ŒÄ‚ń‚¾‚č‚·‚é•Č‚Ŗ•t‚¢‚Ä‚¢‚é
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚É‚·‚é•ū‚Ŗ‚Ž‚µ‚ėˆį˜aŠ“

237 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/12/13(“y) 23:56:31
‚Ø‚¢‚Ø‚¢Agrep‚āsed‚®‚ē‚¢ŒÄ‚яo‚³‚ø‚Éawk‚Å‚ā‚ė‚¤‚ŗB


238 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2008/12/16(‰Ī) 00:29:26
grep‚āsed‚ĶƒpƒCƒv‚Å‚Ā‚Č‚°‚ÄŽg‚¤‚ą‚Ģ‚¶‚į‚Č‚¢‚ĢH(^^;

239 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/01/10(“y) 22:10:41
gawk 3.1.4 mb@‚Ģwindows”Å‚ĢEXEƒtƒ@ƒCƒ‹‚Ŗ—~‚µ‚¢c

240 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/01/11(“ś) 00:38:51
‚Č‚ń‚Å‚»‚ń‚ČŒĆ‚¢ƒo[ƒWƒ‡ƒ“‚Ŗ—~‚µ‚¢‚Ģ?


241 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/01/11(“ś) 12:16:04
>‚Č‚ń‚Å‚»‚ń‚ČŒĆ‚¢ƒo[ƒWƒ‡ƒ“‚Ŗ—~‚µ‚¢‚Ģ?
length‚Ę‚©substr‚ŁAujv•t‚«•¶Žš—ńŠÖ”‚Ŗ‚ ‚é‚©‚ē‚Å‚·B
3.1.5ˆČ~‚¾‚ʁA“Æ‚¶ƒXƒNƒŠƒvƒgƒtƒ@ƒCƒ‹“ą‚ŁAƒoƒCƒg’PˆŹˆ—‚Ę
ƒLƒƒƒ‰ƒNƒ^[’PˆŹˆ—‚Ģ¬Ż‚Ŗ“ļ‹V‚Č‚Ģ‚Å‚·B


242 F240F2009/01/11(“ś) 15:01:36
3.1.5‚Å•¶Žš‚Ģˆµ‚¢‚Ŗ•Ļ‚ķ‚Į‚½‚Ģ‚Ķ‚»‚Ģ’Ź‚č‚¾‚Æ‚ĒA3.1.4‚ĢWindows”Å‚Ä
jlength‚ā‚ē‚ ‚Į‚½‚Į‚Æ?
‚Č‚©‚Į‚½‚ĘŽv‚¤‚ń‚¾‚Æ‚ĒB


243 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/01/11(“ś) 15:48:22
>‚Č‚©‚Į‚½‚ĘŽv‚¤‚ń‚¾‚Æ‚ĒB
‚¦‚ĮB3.1.4ˆČ‘O‚Ģ‚ĶƒoƒCƒg’PˆŹƒIƒ“ƒŠ[‚Į‚ÄŽ–‚Å‚·‚©H
c‚»‚ź‚Å‚ą2ƒoƒCƒgŠ·ŽZ‚ňµ‚¦‚Ī‚¢‚¢‚©‚ēA‚Ü‚¾ƒ}ƒV‚©‚ąB

j•t‚«‚Ŗ’Ē‰Į‚³‚ź‚Ä‚¢‚½‚Æ‚ĒA“®ģ•ĻX‚É”ŗ‚Į‚Ä”pŽ~‚³‚ź‚½c
‚ĘŽv‚Į‚Ä‚¢‚Ü‚µ‚½B
‹L‰Æ‚É‚ ‚é‚Ģ‚ĶA‚Ē‚Č‚½‚©‚Ģ“ĘŽ©Šg’£•ŹVer‚¾‚Į‚½‚Ģ‚©cH


244 F240F2009/01/11(“ś) 17:54:21
> ‚¦‚ĮB3.1.4ˆČ‘O‚Ģ‚ĶƒoƒCƒg’PˆŹƒIƒ“ƒŠ[‚Į‚ÄŽ–‚Å‚·‚©H ‚æ‚į‚¤B
j‚Č‚ń‚Ę‚©‚Ŗ‚ ‚Į‚½‚Ģ‚ĶA
2.11ƒx[ƒX‚Ģjgawk‚Ę2.15ƒx[ƒX‚Ģjgawk
2.15ƒx[ƒX‚Ģ‚Ęgawk+mb
3.0.xƒx[ƒX‚Ģgawk+mb
‚ŁA3.1.xƒx[ƒX‚Ģ‚É‚Ķ‚Č‚©‚Į‚½‚Ę‚¢‚¤˜b‚¾‚Į‚½‚ĘŽv‚¤B
‚»‚ź‚¼‚ź‚ā‚Į‚Ä‚él‚Ŗˆį‚¤B


245 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/01/11(“ś) 19:05:17
>3.1.xƒx[ƒX‚Ģ‚É‚Ķ‚Č‚©‚Į‚½‚Ę‚¢‚¤˜b‚¾‚Į‚½‚ĘŽv‚¤B
‚»‚¤‚Å‚·‚©cB
gawk 3.1.4 mb ‚Ģwindows”Å‚ĢEXEƒtƒ@ƒCƒ‹‚Ŗ—~‚µ‚¢c
‚Å‚Ķ‚Č‚­‚āA
3.0.xƒx[ƒX‚Ģgawk+mb ‚Ģwindows”Å‚ĢEXEƒtƒ@ƒCƒ‹‚Ŗ—~‚µ‚¢c
‚Ę‚¢‚¤Ž–‚É‚Č‚é–ó‚Å‚·‚Ŗc–³—‚Į‚Ū‚¢B
‚ ‚Į‚Ä‚ąŠÖ”‚ā‘gž•Ļ”‚ŖŒø­c‚»‚Ģ‘O‚É16bitDOS”ÅONLY‚Ģ—\Š“cB
’ś‚ß‚Ü‚·B240‚³‚ńA‚Ē‚¤‚ą‚Å‚µ‚½B

246 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/01/11(“ś) 19:50:26
>>245

http://www.hinadori.atnifty.com/~wills/
‚É‚ ‚é‚ęB3.0.6‚Ģ‚ā‚ĀB
DOS”Å‚¾‚Æ‚¶‚į‚Č‚­‚ÄWin32”Å‚ą‚ ‚éB

3.0.6→3.1.x‚Å‘‚¦‚½‹@”\‚Å‚ąŽg‚Į‚Ä‚ń‚Ģ?



247 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/01/11(“ś) 22:30:39
>‚ ‚é‚ęB3.0.6‚Ģ‚ā‚ĀB
‚؂؁B ‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B
>3.0.6Ø3.1.x‚Å‘‚¦‚½‹@”\‚Å‚ąŽg‚Į‚Ä‚ń‚Ģ?
‚¢‚Ā‰½‚Ŗ‘‚¦‚½‚Ģ‚©‚ę‚­”cˆ¬‚µ‚Ä‚¢‚Č‚¢‚ń‚Å‚·‚ŖA
gensub‚Ę‚©mktime‚Ę‚©switch-case‚Ę‚©c‚ ‚č‚Ü‚·‚©‚ĖB
‚Ü‚ A‘ć‘ÖŽč’i‚Ķ‚ ‚é‚Ģ‚ÅŽŽ‚µ‚Ä‚Ż‚Ü‚·B‚Ē‚¤‚ą‚Å‚·B

248 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/02/23(ŒŽ) 08:11:12
awk‚ŁA‘g‚Ż‡‚ķ‚¹‚Ģ‘S‚Ä‚šģ‚éA‚Ę‚¢‚¤Ž–‚Ķ‚Å‚«‚é‚Ģ‚Å‚µ‚傤‚©H
‚¢‚ķ‚ä‚én‚br‚ĢAŒĀ”‚Å‚Ķ‚Č‚­‚āA’†g‚š’m‚č‚½‚¢‚Ę‚¢‚¤Ž–‚Č‚Ģ‚Å‚·‚Ŗ„„„B
imawk‚šŽg‚Į‚Ä‚¢‚Ü‚·j


249 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/02/24(‰Ī) 18:18:34
>>248
‚Å‚«‚Ü‚·

250 FsageF2009/03/04(…) 15:23:19
248‚Å‚·B
‚Č‚ń‚Ę‚©‚Å‚«‚Ü‚µ‚½B249‚³‚ń‚Ē‚¤‚ą‚Å‚·B

251 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/03/04(…) 15:24:16
sageŠŌˆį‚¦‚½c

252 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/03/23(ŒŽ) 11:47:59
int(0.5005*10000)‚Ŗ5004‚É‚Č‚é‚Ģ‚Ķ‚Č‚ŗ‚Å‚·‚©B

253 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/03/23(ŒŽ) 12:41:00
ŠŪ‚ߌė·‚Å‚µ‚傤B
Ų‚čŽĢ‚Ä‘O‚É0.5‘«‚·‚Ę‚©H•v‚µ‚Ä‚Ż‚Ä‚Ķ”@‰½‚Å‚µ‚傤‚©B
Ś‚µ‚­‚ĶAIEEE‚ĘŠŪ‚ߌė·•Ó‚č‚ĢƒL[ƒ[ƒh‚ÅŒŸõ‚Ģ‚±‚ʁB

254 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/03/23(ŒŽ) 19:57:34
>253
‚ ‚č‚Ŗ‚Ę‚¤

255 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/04/13(ŒŽ) 21:36:16
gawk‚ÅŒfŽ¦”Āģ‚č‚½‚¢‚ń‚Å‚·‚Æ‚ĒA
gawk‚ŖŽg‚¦‚é–³—æŽI‚Ē‚±‚©‚É‚ ‚č‚Ü‚¹‚ń‚©H

256 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/04/13(ŒŽ) 21:58:14
Linux‚Ŗ“ü‚Į‚Ă郌ƒ“ƒ^ƒ‹ŽI‚Č‚ē“ü‚Į‚Ä‚é‚ń‚¶‚į‚Č‚¢‚©‚Č‚ŸH
ƒŒƒ“ƒ^ƒ‹ŽI”Ā‚Å‚«‚¢‚Ä‚Ż‚½‚ēB
‚³‚­‚ē‚ĢFreeBSD‚ĶFreeBSD‚Ģawk(!=gawk)‚¾‚Į‚½B

257 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/04/13(ŒŽ) 22:07:10
>>256
‚³‚­‚ē‚Ķgawk‚Å‚·‚©B
Windows‚¶‚į‚Č‚¢ƒŒƒ“ƒ^ƒ‹ŽI‚Č‚ēawk‚ŖŽg‚¦‚Ä‚ą—Ē‚³‚»‚¤‚Å‚·‚Æ‚ĒA
–³—æ‚Å‚Ķ‚Č‚©‚Č‚©Œ©‚Ā‚©‚ē‚Č‚¢‚ń‚Å‚·‚ę‚ĖB
perlCrubyCphp‚Ķ‘½‚¢‚ń‚Å‚·‚Æ‚Ē‚Ė‚„BB

258 F257F2009/04/13(ŒŽ) 22:14:30
Žø—ēB
‚³‚­‚ē‚Ķgawk‚¶‚į‚Č‚¢awk‚Å‚·‚©B

259 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/04/18(“y) 13:07:13
‚ķ‚ē‚¤w
ttp://awk.info/?doc/dsl/awkplusplus.html

object_variable = class_name.new[(optional parameters)]
object_variable.method_name(parameters)
object_variable.delete

260 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/04/18(“y) 13:30:10
>>259
“Æ‚¶‚­ƒEƒP‚½
awk‚Ķ‰i‘±“I‚ÉŽg‚Į‚Ä‚¢‚āCC-->C++-->Java‚ʏę‚čŒp‚¢‚Å‚«‚½‚ŖCawk‚Ķ‚±‚ź‚ēƒRƒ“ƒpƒCƒ‰Œ¾Œź‚šŽg‚¤ć‚Å
—Ē‚¢ŠwKŽ—æ‚É‚Č‚Į‚Ä‚«‚½‚ĘŽv‚¢Š“ŽÓ‚µ‚Ä‚¢‚é(‚ą‚æ‚ė‚ń–¢‚¾‚Éscript‚Ģawk‚šawk‚ŏ‘‚¢‚Ä‚¢‚é)D
—Bˆźawk‚ŕ׋­‚Å‚«‚Č‚©‚Į‚½‚Ģ‚ŖOOP‚¾‚Į‚½‚©‚ēCŠwKŽ—æ‚Ę‚µ‚Ä‚Ģawk‚Ŗ‚±‚¤‚¢‚¤•ūŒü‚ÉŠˆ˜H‚šŒ©‚¢‚¾‚·‚Ģ‚Ķ
—Ē‚¢‚±‚Ę‚©‚ą‚µ‚ź‚Č‚¢D‚½‚¾‚µŽĄ—p‚ÉŒü‚Ƃčl‚¦‚Ä‚Ż‚é‚ʁCŒĀl“I‚É‚ĶOOP‚Ŗ–{—Ģ‚š”­Šö‚·‚é‚Ģ‚Ķ“Ŗ‚Ģ’†‚Åalgorithm‚š
”cˆ¬‚µ‚«‚ź‚Č‚­‚Č‚é’ö“x‚É‘å‚«‚ČƒVƒXƒeƒ€‚š‘g‚Żć‚°‚鏼‡‚Č‚Ģ‚ŁC‰Ź‚½‚µ‚Ä‚»‚ź‚šawk‚ŏ‘‚­‚©‚Ę‚¢‚ķ‚ź‚é‚ʁcD

261 F260F2009/04/18(“y) 13:57:19
s/algorithm/ƒf[ƒ^\‘¢/

262 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/05/09(“y) 23:49:39
Å‹ßruby‚Ģ•×‹­Žn‚ß‚½‚ń‚¾‚ŖA
uruby‚Ŗ‚ ‚ź‚ĪAWK‚¢‚ē‚Ėv‚Ę‚ĶŽv‚¦‚ńB
‹t‚ÉAWK‚Ģ•Ö—˜‚³‚šÄ”FŽÆ‚µ‚½B

‚ā‚Į‚Ļ‚čAŠČ’P‚ČƒeƒLƒXƒgˆ—‚Ķ
AWK‚Å‚ā‚Į‚½‚Ł‚¤‚ŖŠČ’P‚¾B

263 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/05/09(“y) 23:58:09
Šes‚É‘Ī‚µ‚ďˆ—‚Į‚-‡‚Ķawk‚Ŗ—Ē‚¢‚Ė

264 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/05/10(“ś) 00:37:15
ruby‚ĶƒIƒuƒWƒFƒNƒgŽwŒü‚š‹­§‚³‚ź‚é‚©‚ē¬‰ń‚č‚Ŗ‚«‚©‚ń

265 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/05/10(“ś) 01:20:35
JavaScript‚Ŗ“®‚­ HTMLŽĄŒ±•”‰®
ttp://homepage2.nifty.com/tomoarai/java/exper.html


266 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/05/14(–Ų) 08:38:05
jawk‚Ģ˜b‘č‚Ŗ‘S‘Ro‚Č‚¢‚ĖB
Žg‚Į‚Ä‚él­‚Č‚¢‚ĢH

267 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/05/19(‰Ī) 23:16:20
>>266
‚³‚­‚Į‚Ę1s‚ōĻ‚Ž‚Ģ‚Ŗ‹C‚É“ü‚Į‚Ă鉓‚É‚Ķ–³—p‚¾‚Č

268 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/01(ŒŽ) 15:22:34
>>266
JƒA(ƒI)[ƒNAƒvƒ‰ƒOƒAƒEƒbI

269 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/08(ŒŽ) 01:31:39
ttp://gauc.no-ip.org/awk-users-jp/blis.cgi/DoukakuAWK_167
Geocoding - ZŠ‚©‚ēˆÜ“xŒo“x‚šŒŸõ ‚¾‚Į‚āB‰½‚±‚ź‚Ø‚ą‚ė‚¢B

270 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/21(“ś) 16:39:12
{if(miso<$1){printf($1)}} miso=30
‚šŽĄs‚·‚é‚Ę$1‚Ŗ‚PŒ…‚Ģ”Žš‚Ģ‚Ę‚«‚É‚¤‚Ü‚­‚¢‚©‚Č‚¢‚ń‚Å‚·‚Æ‚Ē‚Č‚ŗH

271 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/21(“ś) 19:43:04
•¶Žš—ń‚Å”äŠr‚³‚ź‚Ä‚é‚ń‚¶‚į‚ĖH
miso<$1-0
‚Å‚ā‚Į‚½‚ē‚Ē‚¤H

272 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/21(“ś) 21:34:56
>>271
‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B‚Å‚ą‚¾‚ß‚Å‚µ‚½B
•¶Žš—ń‚Å”äŠr‚³‚ź‚Ä‚é‚Į‚Ū‚¢‚Å‚·‚ĖB

273 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/21(“ś) 22:04:19
>>270
‰½‚š“ü—Ķ‚µ‚½‚Ę‚«‚ɉ½‚Ŗo‚Ä—~‚µ‚¢‚ĢH
‚¤‚Ü‚­‚¢‚©‚Č‚¢‚Į‚Ä‚Ē‚¤‚Č‚é‚ĢH

274 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/21(“ś) 22:23:40
>>273
$1‚Ŗ4‚Ģ‚Ę‚«‚ɏo‚Ä‚Ł‚µ‚­‚Č‚¢‚Ģ‚ɏo‚Ä‚µ‚Ü‚¤‚ń‚Å‚·DDD

275 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/21(“ś) 22:31:41
>>274
‚±‚ń‚Č‚ńH
BEGIN{miso=30}{if(miso<$1){printf("%d\n",$1)}}

276 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/21(“ś) 22:46:46
>>275
o‚Ä‚µ‚Ü‚¤——R‚Ŗ‹C‚É‚Č‚č‚Ü‚·DDD‚Č‚ń‚Å‚Å‚µ‚傤
‚ā‚Į‚Ļ‚č‚Q‚V‚P‚³‚ń‚ĢŒ¾‚¤‚Ę‚Ø‚č•¶Žš—ń”äŠr‚µ‚Ä‚é‚ń‚Å‚µ‚傤‚©H

277 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/21(“ś) 22:54:47
>>276
awk ‚Ģƒo[ƒWƒ‡ƒ“iŽķ•Źj‚Ŗ•Ŗ‚©‚ē‚Č‚¢
‰½‚šH‚ķ‚¹‚Ä‚é‚Ģ‚©•Ŗ‚©‚ē‚Č‚¢
ƒXƒNƒŠƒvƒg‚Ķˆźs‚ŏ‘‚¢‚Ä‚é‚Ģ‚©ƒtƒ@ƒCƒ‹‚É‚µ‚Ä‚é‚Ģ‚©•Ŗ‚©‚ē‚Č‚¢
ˆźs‚ŏ‘‚¢‚Ä‚¢‚é‚Č‚ēƒVƒFƒ‹‚ɉ½‚šŽg‚Į‚Ä‚¢‚é‚Ģ‚©

278 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/22(ŒŽ) 00:38:26
•¶Žš—ń”äŠr‚³‚ź‚Ä‚é‚Č‚ēˆźŒ…‚Ģ‚Ę‚«‚ɏćŽč‚­‚¢‚©‚Č‚¢‚Ę‚¢‚¤‚ę‚č
“ńŒ…‚Ģ‚Ę‚«‚¾‚ƏćŽč‚­‚¢‚­‚Ę‚¢‚¤Š“‚¶‚Č‚Ģ‚©‚ĖB
WindowsXP‚ĢƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒg‚Ågawk(3.1.5)Žg‚Į‚ĉŗ‹L‚šŽŽ‚µ‚Ä‚Ż‚½‚Æ‚Ē
‚»‚ĢŒ»ŪÄŒ»‚Å‚«‚Č‚©‚Į‚½B
gawk "{if(miso<$1){printf($1)}}" miso=30

279 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/22(ŒŽ) 07:43:07
$awk -W version
mawk 1.3.3 Nov 1996, Copyright (C) Michael D. Brennan

compiled limits:
max NF 32767
sprintf buffer 2040
$seq 1 40 | awk '{if(miso<$1)printf($1)}' miso=30
31323334353637383940
‚¤‚Ü‚­“®‚¢‚Ä‚¢‚é‚ꂤ‚¾‚ŖB

280 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/22(ŒŽ) 18:20:09
>>279‚šƒ}ƒl‚³‚¹‚Ä‚ą‚ē‚Į‚½
$ awk -W version
GNU Awk 3.1.6
Copyright (C) 1989, 1991-2007 Free Software Foundation.

$ seq 1 40 | awk '{if(miso<$1)printf($1)}' miso=30
31323334353637383940

281 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/22(ŒŽ) 19:59:10
miso=30‚Į‚Ä-v•t‚Æ‚Č‚­‚Ä‚¢‚Æ‚é‚ń‚¾B‚µ‚ē‚ń‚©‚Į‚½B

282 F270 ‚Ģ‚ŖÄŒ»‚Å‚«‚Č‚¢...F2009/06/23(‰Ī) 01:02:55
gawk‚Ķ
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ÅŽw’č‚³‚ź‚½ƒtƒ@ƒCƒ‹–¼‚Ŗ var=val ‚Ę‚¢‚¤Œ`Ž®‚Č‚ē‚ĪA‚»‚ź‚Ķ•Ļ”‚Ö‚Ģ‘ć“ü‚Å‚ ‚é‚ʉšŽß‚³‚ź‚Ü‚·B•Ļ” var ‚Ķ’l val ‚ɐŻ’č‚³‚ź‚Ü‚· (‚±‚ź‚ĶA‚·‚ׂĂĢ BEGIN ƒuƒƒbƒN‚šŽĄs‚µ‚½‚ ‚Ę‚És‚ķ‚ź‚Ü‚·)B


‚ā‚Į‚Ļ‚č‚ą‚ź‚Ģ XPƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒgŠĀ‹«‚Å‚ą
>gawk -W version
GNU Awk 3.1.6
Copyright (C) 1989, 1991-2007 Free Software Foundation.

>seq 1 40 | gawk "{if(miso<$1) print}" miso=30
31
32
33
34
35
36
37
38
39
40

‚Į‚ÄŠś‘Ņ’Ź‚č‚Ģ“®‚«‚¾YO!

283 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/24(…) 00:39:07
ŒÅ’č’·‚ʼnüs‚Č‚µ‚Ģƒtƒ@ƒCƒ‹i6MB’“j‚šˆ—‚·‚邱‚Ę‚É‚Č‚čA
‘¼‚Ģƒ\ƒtƒg‚Å¢‰üs‚ ‚č‚ĢŒÅ’č’·£‚É‚µ‚Ä‚©‚ēAawk‚ŏˆ—‚µ‚Ä‚¢‚½‚Ģ‚Å‚·‚Ŗc

ƒf[ƒ^ƒtƒ@ƒCƒ‹‚É‚ę‚­o‚Ä‚­‚镶Žš‚š‚Ę‚č‚ ‚¦‚øRS‚ÉŒ©—§‚Ä‚Ä“Ē‚Żž‚Ż
ØRS‚ÉŽw’肵‚½•¶Žš‚š˜AŚ
ØŒÅ’č’·‚Ģ1s•Ŗ‚ę‚č’·‚©‚Į‚½‚ē‚»‚Ģ•”•Ŗ‚šŲ‚čo‚µ

‚µ‚Ä‚¢‚­‚Ę¢‰üs‚ ‚č‚ĢŒÅ’č’·£A‚Å‚«‚æ‚į‚¢‚Ü‚µ‚½B
RS‚ÉŽw’肵‚½•¶Žš‚Ŗ‚µ‚Ī‚ē‚­o‚Ä‚±‚Č‚Æ‚ź‚Ī•Ļ”ƒpƒ“ƒN‚µ‚æ‚į‚¤‚µA‘å•ŖŠė‚Č‚Į‚©‚µ‚¢‚Ģ
‚Å‚·‚ŖA‚Ę‚č‚ ‚¦‚øawk‚Å‚Å‚«‚½‚Ģ‚Ŗ­‚µ‚¤‚ź‚µ‚¢B

284 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/24(…) 03:25:12
‰üs‚ ‚č‚ĢŒÅ’č’·‚šawk‚Å“Ē‚ń‚¾‚Ģ‚Č‚ē
substr($0, start, length) ‚Å‚Ī‚ē‚¹‚ęw

285 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/26(‹ą) 11:29:46
>>283
>284‚Ż‚½‚¢‚Č“Ē‰š—Ķ‚Č‚¢”nŽ­‚Ŗ—N‚©‚Č‚¢‚ꂤ‚ɁA”»‚čˆÕ‚­‘‚«‚Ü‚µ‚傤B
‚Ā[‚©A‹ļ‘Ģ“I‚ČƒR[ƒh‚ąo‚³‚ø‚Ɂuawk‚Å‚Å‚«‚Ä‚¤‚ź‚µ‚¢v‚Č‚ń‚Ä‚Ģ‚Ķƒ`ƒ‰ƒV‚Ģ— ‚É‚Ē‚¤‚¼B

286 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/06/30(‰Ī) 01:27:46
fold ‚Ę‚©H

287 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/07/13(ŒŽ) 09:52:52
³‹K•\Œ»‚Å‹ó”’‚Å‹ęŲ‚ē‚ź‚½ƒeƒLƒXƒg‚šHTML‚Å‚¢‚¤table‚É‚µ‚½‚¢‚Å‚·B
—įj

10i 2i 8i
000 000 000
001 001 001
002 010 002
003 011 003

«««««««

<table>
<tr><th>10i</th> <th>2i</th> <th>8i</th></tr>
<tr><td>000</td> <td>000</td> <td>000</td></tr>
<tr><td>001</td> <td>001</td> <td>001</td></tr>
<tr><td>002</td> <td>010</td> <td>002</td></tr>
<tr><td>003</td> <td>011</td> <td>003</td></tr>
</table>

288 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/07/13(ŒŽ) 12:07:49
>>287
³‹K•\Œ»‚šŽg‚¤‚Ł‚Ē‚Ģ‚±‚Ę‚Å‚Ķ‚Č‚¢
ƒRƒA‚Ģ•”•Ŗ‚¾‚Ə‘‚­‚Ę‚±‚ź‚¾‚Æ
for(i=1;i<=NF;i++) printf("<td>%s</td>", $i)

289 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/07/13(ŒŽ) 16:12:21
³‹K•\Œ»Žg‚Į‚ă^ƒO‚šŲ‚č‘Ö‚¦‚½‚¢‚Ģ‚©‚ȁH

290 FhogehogeF2009/07/17(‹ą) 16:37:34
split ‚ā asort ‚µ‚½‚ē‚Ē‚¤‚µ‚Ä“YŽš‚Ŗ1‚©‚ē‚É‚Č‚é‚ń‚¾I
‚Č‚ń‚Å‚¾I
Žd—l‘“Ē‚Ż”ņ‚Ī‚µ‚Ăăf[ƒ^Œ‡—Ž‚³‚¹‚é‚Ę‚±‚ė‚¾‚Į‚½(L„ƒÖ„M)

>>287
sed ‚Å‚¦‚¦‚ā‚ń

291 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/07/17(‹ą) 18:35:54
”‚Ü‚Åawk '{print $3}'’ö“x‚µ‚©Žg‚Į‚Ä–³‚©‚Į‚½‚ŖAÅ‹ß‚±‚ź‚š“Ē‚ń‚Åawk‚šŒ©’¼‚µ‚½B

http://www.eecs.harvard.edu/cs152/lectures/CS152-Lecture_14-Kernighan.pdf

292 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/07/26(“ś) 15:10:31
ttp://www.kt.rim.or.jp/~kbk/gawk-3.1/
‚±‚±‚Ģgawk‚Å>>17‚ĢƒTƒ“ƒvƒ‹‚šŽŽ‚µ‚½‚Ŗ“®‚©‚Č‚©‚Į‚½B

gawk: test.awk:4: ’v–½“I: “üo—Ķ—p‚Ģ‘o•ūŒüƒ\ƒPƒbƒg `/inet/tcp/0/www.yahoo.com/80' ‚ŖŠJ‚Æ‚Ü‚¹‚ń (No such file or directory)B

293 FhogehogeF2009/07/27(ŒŽ) 11:13:15
‚»‚ź‚Ķ‚»‚±‚ĢƒTƒCƒg‚Ģl‚ÉŒ¾‚¦‚ę

294 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/07/28(‰Ī) 00:11:42
‚¢‚Ā‚Ģ‚Ü‚É‚©gawk 3.1.7‚Ŗo‚Ä‚½B

295 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/07/30(–Ų) 11:45:58
Ruby •×‹­’†‚¾‚Æ‚Ē AWK ‚Ģ‚Ł‚¤‚ŖŠy‚µ‚¢‚ŗ(L„ƒÖ„M)

296 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/06(–Ų) 10:22:37
7ŒŽ7“śØ[[7ŒŽ7“ś|07ŒŽ07“ś]]
7ŒŽ28“śØ[[7ŒŽ28“ś|07ŒŽ28“ś]]
11ŒŽ3“śØ[[11ŒŽ3“ś|11ŒŽ3“ś]]
12ŒŽ16“śØ[[12ŒŽ16“ś|12ŒŽ16“ś]]

‚Ę’u‚«Š·‚¦‚½‚¢‚Å‚·B
perl‚Č‚ē‚ķ‚č‚ĘŠČ’P‚Č‚Ģ‚Å‚·‚ŖAawk‚ÅŠČ’P‚É‚¢‚«‚Ü‚·‚©H
Ž©•Ŗ‚Ŗawk‚Ģ‚±‚Ę‚š•×‹­•s‘«‚¾‚©‚ē‚©‚ą‚µ‚ź‚Ü‚¹‚ń‚Æ‚ĒcB

297 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/06(–Ų) 10:24:13
ŖŠŌˆį‚¢‚Ü‚µ‚½B
7ŒŽ7“śØ[[7ŒŽ7“ś|07ŒŽ07“ś]]
7ŒŽ28“śØ[[7ŒŽ28“ś|07ŒŽ28“ś]]
11ŒŽ3“śØ[[11ŒŽ3“ś|11ŒŽ03“ś]]
12ŒŽ16“śØ[[12ŒŽ16“ś|12ŒŽ16“ś]]

298 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/06(–Ų) 11:03:17
—į‚Ŗ‚ę‚­‚ķ‚©‚ē‚Č‚¢‚ń‚¾‚Æ‚ĒC”Žš1Œ…‚Ģ•”•Ŗ‚š2Œ…‚É‚µ‚½‚¢‚Į‚Ä‚±‚ʁH

299 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/06(–Ų) 11:13:12
{
gsub(/ŒŽ|“ś/," ");
printf("%02dŒŽ%02d“ś\n",$1,$2);
}
‚Ę‚©D
ƒtƒB[ƒ‹ƒhƒZƒpƒŒ[ƒ^‚ŖƒfƒtƒHƒ‹ƒg(”¼ŠpƒXƒy[ƒX)‚Ģź‡‚ĖD

300 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/06(–Ų) 11:15:10
>296
Perl‚ÅŠČ’P‚ɏ‘‚Æ‚é‚Č‚ēAˆź’UPerlƒR[ƒhŽN‚µ‚Ä‚­‚ź‚é‚©H
‚Ē‚¤‚ąŽd—l‚Ŗ‚ę‚­‰š‚ē‚ń‚Ģ‚¾c

301 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/06(–Ų) 11:54:28
print gensub(/0([0-9])([0-9])/, "\\1\\2", "g", gensub(/([0-9]+)/, "0\\1", "g",
$1))

‰ä‚Č‚Ŗ‚ē‰˜‚Ė‚„‚Č‚Ÿ(L„ƒÖ„M)
>>299‚Ģ•ū‚Ŗ‚¢‚¢‚Č

302 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/06(–Ų) 12:27:22
>>298,300 ’uŠ·‚µ‚Č‚¢‚Å•Ļ‚¦‚½‚¢‚Ę‚±‚¾‚Əo—Ķ‚·‚é‚Č‚ē‚±‚¤‚¢‚¤ˆÓ–”‚Å‚·B
#!/usr/bin/perl
while(1){
$line = <STDIN>;
if($line =~ /(0?[1-9]|1[0-2])ŒŽ(0?[1-9]|[1-2][0-9]|3[01])“ś/){
$month = $1; $day = $2;
if($month >= 10) {
if($day >=10){
print "$& -> [[$monthŒŽ$day“ś]]";
}
else {
print "$& -> [[$monthŒŽ$day“ś|$monthŒŽ0$day]]";
}
}
else{
if($day >=10){
print "$& -> [[$monthŒŽ$day“ś|0$monthŒŽ$day]]";
}
else{
print "$& -> [[$monthŒŽ$day“ś|0$monthŒŽ0$day]]";
}
}
}
}
1ŒŽ1“ś - ƒ†[ƒ“±“ü10Žü”NB
1ŒŽ1“ś -> [[1ŒŽ1“ś|01ŒŽ01]]
12ŒŽ31“ś - ƒjƒ…[ƒˆ[ƒN‚Ģƒ}ƒ“ƒnƒbƒ^ƒ“‹“ŠJ’Ź100Žü”NB
12ŒŽ31“ś -> [[12ŒŽ31“ś]]
8ŒŽ21“ś - ƒnƒƒCBB§50Žü”NB
8ŒŽ21“ś -> [[8ŒŽ21“ś|08ŒŽ21]]
10ŒŽ1“ś - ƒpƒ‰ƒI“Ę—§15Žü”NB
10ŒŽ1“ś -> [[10ŒŽ1“ś|10ŒŽ01]]

303 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/06(–Ų) 14:16:23
‚Č‚ń‚©‘f’¼‚ÉPerl‚Å‚ā‚Į‚½‚Ł‚¤‚ŖŠy‚»‚¤‚¾‚Č‚ A‚»‚źB
‚æ‚Č‚Ż‚ɁA‚»‚ĢƒR[ƒh‚¶‚į–³ŒĄƒ‹[ƒv‚·‚邼B
#!/usr/bin/perl
while($line = <STDIN>) {
    if($line =~ /(0?[1-9]|1[0-2])ŒŽ(0?[1-9]|[1-2][0-9]|3[01])“ś/) {
        $month = $1; $day = $2;
        if($month < 10 || $day < 10) {
            printf "%s -> [[%dŒŽ%d“ś|%02dŒŽ%02d]]\n", $&, $month, $day, $month, $day;
        }
        else {
            print "$& -> [[$monthŒŽ$day“ś]]\n";
        }
    }
}

304 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/06(–Ų) 14:44:03
‚¾‚ß‚¾cƒR[ƒh‚ĢˆÓ–”‚Ķ•Ŗ‚©‚é‚ŖCŽd—l‚Ŗ—Ē‚­•Ŗ‚©‚ē‚ńD

305 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/06(–Ų) 14:47:14
7ŒŽ7“ś
‚Ę‚¢‚¤•¶Žš—ń‚š
[[7ŒŽ7“ś|07ŒŽ07“ś]]
‚Ę’u‚«Š·‚¦‚éA‚Į‚Ä‚±‚Ę‚Å‚µ‚åB
‚Č‚ń‚Å•Ŗ‚©‚ē‚ń‚©‚Č‚ŸB‚»‚Į‚æ‚Ģ‚Ŗ•Ŗ‚©‚ē‚ńB

306 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/06(–Ų) 14:53:30
“ü—Ķ‚Ŗ07ŒŽ07“ś‚¾‚Į‚½‚ēC
o—Ķ‚Ķ[[07ŒŽ07“ś|07ŒŽ07“ś]]‚É‚Č‚é‚ę‚ĖH‚±‚ź‚ĶOK?
‚»‚ą‚»‚ąC‚»‚¤‚¢‚¤“ü—Ķ‚Ķ‹N‚±‚肦‚Č‚¢‚ĢH

307 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/06(–Ų) 18:17:38 ?2BP(0)
>>305
‚»‚ń‚ČŠ“‚¶‚Å‚·B
–Ś“I‚šŒ¾‚Į‚Ä‚¢‚Č‚¢‚Ģ‚ŁA‰½‚Ŗ‚ā‚č‚½‚¢‚Ģ‚©‚ę‚­‚ķ‚©‚ē‚Č‚¢‚Ģ‚¾‚ĘŽv‚¢‚Ü‚·B
‘‚¢˜bAWiki‚Ģ‹L–@‚šŽg‚Į‚ăŠƒ“ƒN‚š’£‚č‚½‚¢‚Ģ‚Å‚·B
0‚š‚­‚ķ‚¦‚ÄŒ…‚š’²®‚µ‚Ä‚¢‚闝—R‚Ķ
•¶Žš—ń‚Ę‚µ‚ă\[ƒg‚µ‚Đ³‚µ‚­ø‡‚É•Ą‚Ō‚ꂤ‚É‚·‚邽‚ß‚Å‚·B—į‚¦‚ĪWikipedia‚Č‚ē
7ŒŽ7“ś‚Ģ‚Ę‚«‚ĶA[[7ŒŽ7“ś|07ŒŽ07“ś]]‚Ę‚·‚邱‚Ę‚Å
ƒŠƒ“ƒN‚Ķhttp://ja.wikipedia.org/wiki/7ŒŽ7“ś
•\Ž¦‚³‚ź‚镶Žš—ń‚Ķ 07ŒŽ07“ś@
‚Ę‚Č‚č‚Ü‚·B
‚±‚ź‚šƒ\[ƒg‚Å‚«‚éƒe[ƒuƒ‹‚Ģ—v‘f‚É‚µ‚Ü‚·BŽQl‚Ü‚Å‚É
http://ja.wikipedia.org/wiki/Help:%E8%A1%A8%E3%81%AE%E4%BD%9C%E3%82%8A%E6%96%B9#.E5.86.8D.E6.95.B4.E5.88.97.E5.8F.AF.E8.83.BD.E3.81.AA.E8.A1.A8
‚±‚Ģˆ—‚Ķawk‚Å‚ą‰Ā”\‚Č‚±‚Ę‚Ķ‰Ā”\‚¾‚Į‚½‚ń‚Å‚·‚ŖA–³’m‚Č‚¹‚¢‚©
‚Ø‚»‚ė‚µ‚­•sŠiD‚É‚Č‚č‚Ü‚µ‚½B

>>306
‚»‚źŽv‚¢‚Ü‚µ‚½B‚Å‚«‚ź‚Ī
07ŒŽ07“ś->[[7ŒŽ7“ś|07ŒŽ07“ś]]
‚Ģ‚ꂤ‚ɏˆ—‚µ‚½‚¢‚Å‚·B

308 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/06(–Ų) 18:26:07
>>303
‚»‚ź‚Å‚·B‚»‚¤‚¢‚¤ˆÓ–”‚Å‚·B

309 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/06(–Ų) 21:17:06
# gawk ‚É‚ę‚é match ŠÖ”‚ĢŠg’£‚šŽg‚Į‚Ä‚¢‚é.
# ˆźs‚É•””‰ńŒ»‚ź‚½ź‡‚Ķ–³Ž‹.

BEGIN {
    F = "(0?[1-9]|1[0-2])ŒŽ(0?[1-9]|[1-2][0-9]|3[01])“ś";
}

{
    if ($0 ~ F) {
        match($0, F, a);
        if (a[1]+0 < 10 || a[2]+0 < 10) {
            sub(a[0], sprintf("[[%dŒŽ%d“ś|%02dŒŽ%02d“ś]]", $0, a[2], a[1], a[2], a[1]));
        } else {
            sub(a[0], sprintf("[[%dŒŽ%d“ś]]", $0, a[2], a[1]));
        }
    }
    print $0;
}

310 F309F2009/08/06(–Ų) 21:21:15
# ’ł³.

BEGIN {
    F = "(0?[1-9]|1[0-2])ŒŽ(0?[1-9]|[1-2][0-9]|3[01])“ś";
}

{
    if ($0 ~ F) {
        match($0, F, a);
        if (a[1]+0 < 10 || a[2]+0 < 10) {
            sub(a[0], sprintf("[[%dŒŽ%d“ś|%02dŒŽ%02d“ś]]", a[1], a[2], a[1], a[2]));
        } else {
            sub(a[0], sprintf("[[%dŒŽ%d“ś]]", a[1], a[2]));
        }
    }
    print $0;
}

311 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/06(–Ų) 23:59:03
>>310 Š®ąų‚Å‚·B”“x‚©‚ē‚±‚ź‚šŽg‚¢‚Ü‚·—L“ļ‚¤‚²‚“‚¢‚Ü‚µ‚½B

$ cat test.txt
1ŒŽ1“ś #mŒŽd“ś
01ŒŽ1“ś #0mŒŽd“ś
1ŒŽ01“ś #mŒŽ0d“ś
01ŒŽ01“ś #0mŒŽ0d“ś

2ŒŽ10“ś #mŒŽdd“ś
02ŒŽ10“ś #0mŒŽdd“ś

11ŒŽ3“ś #mmŒŽd“ś
11ŒŽ03“ś #mmŒŽ0d“ś

12ŒŽ16“ś #mmŒŽdd“ś

$ awk -f test.awk test.txt
[[1ŒŽ1“ś|01ŒŽ01“ś]] #mŒŽd“ś
[[1ŒŽ1“ś|01ŒŽ01“ś]] #0mŒŽd“ś
[[1ŒŽ1“ś|01ŒŽ01“ś]] #mŒŽ0d“ś
[[1ŒŽ1“ś|01ŒŽ01“ś]] #0mŒŽ0d“ś

[[2ŒŽ10“ś|02ŒŽ10“ś]] #mŒŽdd“ś
[[2ŒŽ10“ś|02ŒŽ10“ś]] #0mŒŽdd“ś

[[11ŒŽ3“ś|11ŒŽ03“ś]] #mmŒŽd“ś
[[11ŒŽ3“ś|11ŒŽ03“ś]] #mmŒŽ0d“ś

[[12ŒŽ16“ś]] #mmŒŽdd“ś

312 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/07(‹ą) 06:34:47
Å‰‚É‚»‚¤‚¢‚¤ƒeƒXƒgƒoƒ^[ƒ“‚šo‚»‚¤‚Ė

313 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/07(‹ą) 11:45:35
‚±‚±‚ĢZl‚ŖƒR[ƒfƒBƒ“ƒOD‚«‚¾‚©‚ē‚Į‚ÄŠĆ‚¦‚ā‚Ŗ‚Į‚Ä(L„ƒÖ„M)

> perl‚Č‚ē‚ķ‚č‚ĘŠČ’P‚Č‚Ģ‚Å‚·‚ŖAawk‚ÅŠČ’P‚É‚¢‚«‚Ü‚·‚©H
‚Į‚ÄŒ¾‚Į‚Ä‚é‚ń‚¾‚©‚ēAu‚¢‚«‚Ü‚·v‚Į‚Ä“š‚¦‚č‚į‚¢‚¢‚ń‚¾‚ę‚Č

314 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/07(‹ą) 11:46:39
>>312
‚Č‚É‚»‚ĢŽ€‚Ģsi‚±‚ķ‚¢

315 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/15(“y) 11:36:30
ƒoƒ^[ƒ“@ƒeƒXƒg‚ĢƒfƒXƒ}[ƒ`

316 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/08/16(“ś) 09:46:09
>>294
3.1.7ƒx[ƒX‚ĢWindows—pƒoƒCƒiƒŠAo‚Ü‚µ‚½B
ttp://www.kt.rim.or.jp/%7Ekbk/gawk-3.1/index.html#GAWK-DOWNLOAD

317 F222.248.109.70F2009/08/17(ŒŽ) 17:45:07
Ž©“®Äl š@@Ž©“®•ŪŽē ŸKAWORUKOFI@@Ž©“®•ŪŽē#K9K?_D[L

–¼Œ¾W@‚»‚Ģ‚R
w‚¢‚Ā‚ąƒTƒ{‚Į‚Ä‚Ī‚©‚č‚ĢƒLƒƒƒbƒv‚ŖƒEƒ[‚¦x

http://yutori7.2ch.net/test/read.cgi/news4vip/1249830540/@ID:PVAf+dux0@@Ž©“®Äl š
> 71 FˆČ‰ŗA–¼–³‚µ‚É‚©‚ķ‚č‚Ü‚µ‚ÄVIP‚Ŗ‚Ø‘—‚肵‚Ü‚· [sage] F2009/08/10(ŒŽ) 00:58:57.28 ID:PVAf+dux0
> >>69
> ‘å•Ļ‚Į‚ÄŒ¾‚¤‚©
> –ˆ“śA•ń‚³‚ź‚½‚Ģ‚šŒ©‚āA”»’f‚µ‚āAˆ—‚µ‚āAŠ®—¹•ń‚µ‚āAˆČ‰ŗƒ‹[ƒvB
> ‚æ‚å‚Į‚Ę‚Å‚ąƒ~ƒX‚·‚é‚ʁA•’i‚Ķģ‹Ę‚ą‚µ‚Ä‚Č‚¢ƒLƒƒƒbƒv‚³‚ń‚½‚æ‚Ŗ‚³‚ń‚“‚ń•¶‹åŒ¾‚Į‚Ä‚«‚Ä
> ‚»‚ĢŒ¾‚¢‚ķ‚Æ‚šl‚¦‚Č‚¢‚ʁAƒLƒƒƒbƒv‚Ķ‚­’D‚³‚ź‚½‚čƒAƒJƒEƒ“ƒg“€Œ‹‚³‚ź‚½‚č‚·‚é‚©‚ē
>
> “o˜^‚³‚ź‚Ä‚©‚ēˆź”NˆČćŒo‚Į‚āA‚ā‚Į‚Ę‚¢‚¢‚½‚¢‚±‚ĘŒ¾‚¦‚é‚ꂤ‚É‚Č‚Į‚Ä‚«‚½‚ęB



----------------------------------------------
‚±‚ĢŽ©“®Äl šƒ[ƒ‹ƒ}ƒKƒWƒ“‚Ģ”zM’āŽ~‚š‚²Šó–]‚³‚ź‚é•ū‚Ķ
http://qb5.2ch.net/test/read.cgi/sec2chd/1250169591/
‚É‚ÄŽ©“®Äl š‚Ü‚Å‚²˜A—‚­‚¾‚³‚¢

318 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/10/24(“y) 17:23:04
ÅŒć‚Ģ10s‚šˆ—‚µ‚½‚­‚Č‚¢ź‡A‚Ē‚¤‘‚Æ‚Ī—Ē‚¢‚Å‚µ‚傤‚©H

319 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/10/24(“y) 18:19:03
ÅŒć‚Ü‚Å“Ē‚Ü‚ø‚ɍŌć‚Ģ10s‚©‚Ē‚¤‚©”»’č‚·‚é•ū–@‚Ķ–³‚¢‚¾‚ė‚¤‚Č
ˆ—‘ĪŪ‚Ŗƒtƒ@ƒCƒ‹‚Č‚ēAŽ–‘O‚Éwc -l‚©‰½‚©‚ōs”’²‚×‚Ä awk ‚É“n‚µ‚Ä‚Ż‚Ä‚Ķ

320 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/10/24(“y) 18:52:07
¬‚é’öA‚±‚źA‚Ę‚¢‚¤•ū–@‚Ķ–³‚³‚»‚¤‚Å‚·‚Ė
‚æ‚å‚Į‚ʍl‚¦‚Č‚Ŗ‚ē‚ā‚Į‚Ä‚Ż‚Ü‚·

321 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/10/24(“y) 19:15:52
‚Ę‚č‚ ‚¦‚øA‚±‚ń‚ČŠ“‚¶‚É‚µ‚Ü‚µ‚½
BEGIN {
SKIPTAILS = 10
}
{
line = buf[1]
for(i=1;i<SKIPTAILS;i++) buf[i] = buf[i+1]
buf[SKIPTAILS] = $0
}
NR > SKIPTAILS {
# line‚šˆ—
}

322 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/10/24(“y) 22:11:41
>>321 l‚¦•ū‚Ķ“Æ‚¶‚¾‚Æ‚ĒAfor‚Ŗ‹C‚É‚Č‚Į‚½‚Ģ‚Å
ƒŠƒ“ƒOƒoƒbƒtƒ@‚ŏˆ—‚·‚é‚ꂤ‚É‚µ‚Ä‚Ż‚½B

BEGIN {
@@SKIPTAILS = 10
@@ringpos = SKIPTAILS
}
{
@@ringpos = (ringpos + 1) % SKIPTAILS
@@line = buf[ringpos]
@@buf[ringpos] = $0
}
NR > SKIPTAILS {
@@# line‚šˆ—
}


323 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/10/24(“y) 23:18:06
‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·
ƒŠƒ“ƒOƒoƒbƒtƒ@A•×‹­‚É‚Č‚č‚Ü‚µ‚½
Žg‚ķ‚¹‚Ä’ø‚«‚Ü‚·


324 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/11/19(–Ų) 20:22:22
>>42
sed awk ‚µ‚Ä‘DŽR‚É“o‚é@‚¾‚ėH


325 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/11/23(ŒŽ) 12:06:14
Žæ–ā‚Å‚·
gawk‚Å
{
printf("%d,%s\n", NR, $0 ) > FILENAME;
}
‚Ę‚¢‚¤s“Ŗ‚É”Ō†‚šU‚Į‚Ä•Ū‘¶‚·‚鏈—‚š‚µ‚Ä

batƒtƒ@ƒCƒ‹‚ňźŠ‡ˆ—‚³‚¹‚ꂤ‚Ę‚µ‚½‚ń‚Å‚·‚Ŗ
c:\windows\gawk\gawk -f g:\ģ‹Ę—p\n.awk g:\ģ‹Ę—p\*.txt

ŽĄsŒ‹‰Ź‚Ŗ
ƒtƒ@ƒCƒ‹1@@ƒtƒ@ƒCƒ‹2
1‚`@@@@@@4‚c@@
2‚a@@@@@@5‚d@
3‚b@@@@@@6‚e
‚É‚Č‚č‚Ü‚·

ƒtƒ@ƒCƒ‹2‚ą
1‚c
2‚d
3‚e
‚É‚·‚é‚É‚Ķ‚Ē‚¤‚µ‚½‚ē‚ę‚¢‚Å‚µ‚傤‚©H

326 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/11/23(ŒŽ) 12:27:22
FNR

327 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/11/23(ŒŽ) 12:35:21
>>326
‚؂؁Ao—ˆ‚½I
v‘¬‚ȉń“š‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·

328 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/12/21(ŒŽ) 13:53:34
”N––‚Ƀpƒ\ƒRƒ“‚š”ƒ‚¢Š·‚¦‚ꂤ‚ĘŽv‚Į‚Ä‹@Žķ‘I‚Ń‚š‚µ‚Ä‚¢‚Ä‚Ó‚Ę‹C‚Ć‚¢‚½A
‚ ‚źAvaio‚ĢOS‚ŖWindows7 64bitƒo[ƒWƒ‡ƒ“‚ɁEEE
ƒ_ƒ‚¶‚į‚ńIgawk‚ŖŽg‚¦‚Č‚­‚Č‚Į‚Ä‚µ‚Ü‚¤EEE
‚¤[‚ńAAA‚Ü‚½XP‚š”ƒ‚¤‚ׂ«‚©EEE”Y‚ŽEEE

329 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2009/12/21(ŒŽ) 14:21:01
>>328
Ž©•Ŗ‚ŃRƒ“ƒpƒCƒ‹‚µ’¼‚¹‚Ī‚¢‚¢‚¾‚Æ‚¶‚į‚Č‚¢‚ĢH

330 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/01/14(–Ų) 03:52:20
ƒvƒƒOƒ‰ƒ~ƒ“ƒOŒ¾ŒźAWK•œŠ§‚¾‚Į‚Ä‚ĖB
ttp://slashdot.jp/developers/article.pl?sid=10/01/06/0345207

‘½•Ŗ•K—v«‚šŠ“‚¶‚Č‚¢’ö“x‚É‚ĶŽg‚Į‚Ä‚é‚©‚ēA”ƒ‚ķ‚Č‚¢‚Æ‚ĒŠš‚µ‚¢B
•z‹³—p‚É”ƒ‚¤‚Į‚Ä‚Ģ‚ą‚æ‚å‚Į‚ʂȁB



331 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/02/28(“ś) 11:08:56
AAA BBB CCC c -O ZZZ YYY XXX c

awkVŽQ‚Å‚·B
-O(ƒIƒvƒVƒ‡ƒ“)‚šŒŸõ‚µA
-O‚Ę‚»‚źˆČ~‚šƒŠƒ_ƒCƒŒƒNƒg‚µ‚½‚¢‚Ģ‚Å‚·‚Ŗc
—Ē‚¢•ū–@A‚ ‚č‚Ü‚·‚Å‚µ‚傤‚©

332 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/02/28(“ś) 15:36:31
ƒŠƒ_ƒCƒŒƒNƒg‚Į‚Ä‚Ē‚¤‚¢‚¤ˆÓ–”‚ÅŽg‚Į‚Ä‚é?

‚»‚Ģ AAA ‚ÅŽn‚܂镶Žš—ń‚ąˆź‘Ģ‚Ē‚¤‚¢‚¤‚ą‚Ģ‚Č‚ĢB
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ˆų”‚Č‚Ģ‚©Aƒtƒ@ƒCƒ‹‚©‚ē“Ē‚Żž‚ń‚Å‚­‚é‚Ģ‚Ę‚©B

—pŒź‚Ęó‹µ‚Ķ‚«‚æ‚ń‚ʏ‘‚¢‚Ä‚­‚źB


333 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/02/28(“ś) 16:19:07
D:\My Documents\gawk\331>type 331.txt
AAA BBB CCC c -O ZZZ YYY XXX 0c
AAA BBB CCC c -O ZZZ YYY XXX 1c
AAA BBB CCC c -O ZZZ YYY XXX 2c

D:\My Documents\gawk\331>type 331.awk
{match($0, " -O .*", a);
print a[0];}

D:\My Documents\gawk\331>gawk -f 331.awk 331.txt >a.txt

D:\My Documents\gawk\331>type a.txt
-O ZZZ YYY XXX 0c
-O ZZZ YYY XXX 1c
-O ZZZ YYY XXX 2c

D:\My Documents\gawk\331>

334 F331F2010/02/28(“ś) 18:43:32
ƒŒƒX‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B

>>332‚·‚Ż‚Ü‚¹‚ńB‘‚«’¼‚µ‚Ü‚·B
AAA BBB CCC c -O ZZZ YYY XXX c
‚ʏ‘•””s‘‚©‚ź‚½ƒtƒ@ƒCƒ‹‚Ŗ‚ ‚čA
u-OvˆČ~‚Ģ•¶Žš—ń‚š•Źƒtƒ@ƒCƒ‹‚É•Ū‘¶‚·‚é
‚Į‚Ä‚±‚Ę‚š‚µ‚½‚©‚Į‚½‚Ģ‚Å‚·B

>>333
ƒGƒXƒp[‚Č•¶‚¾‚Į‚½‚Ģ‚É‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B
‘z’肵‚Ä‚½‚Ģ‚Ķ‚»‚ń‚ČŠ“‚¶‚Å‚·B
‚½‚¾ˆČ‰ŗ‚ĢƒGƒ‰[‚Ŗo‚ďćŽč‚­‚¢‚«‚Ü‚¹‚ńc

gawk: 331.awk:2: fatal: match() cannot have 3 arguments

matchŽg‚Į‚Ä‚é‚Ģ‚Éa‚Ę‚¢‚¤3‚Ā–Ś‚Ģˆų”‚šŽg‚Į‚Ä‚é‚©‚ēc‚Į‚Ä‚±‚Ę‚Å‚µ‚傤‚©cH


335 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/02/28(“ś) 19:00:04
Q: make spits out errors like Makefile.awk:256: fatal: match() cannot have 3 arguments

A: Your AWK is too old to recreate the Makefile. The build is done based on the distributed Makefile. Everything shall compile successfully though.
So if the compile succeeds just ignore such errors, please.

336 F335F2010/02/28(“ś) 19:22:38
{print substr($0, match($0, " -O .*")+1);}

337 F331F2010/02/28(“ś) 20:03:12
>>336
o—ˆ‚Ü‚µ‚½B‚Ü‚³‚©–{“ś’†‚ɉšŒˆ‚Å‚«‚é‚Ę‚ĶŽv‚¢‚Ü‚¹‚ń‚Å‚µ‚½B
‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B‘å•Ļ•×‹­‚É‚Č‚č‚Ü‚µ‚½B

338 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/02/28(“ś) 22:25:50
ĪŽæ@–{“–‚ɕ׋­‚É‚Č‚Į‚½‚©‚Ē‚¤‚©‚Ķ‹^–ā‚¾„„„
@‚Ø‚Į‚ĘˆźŒ¾ƒIƒE‚©‚Į‚½‚©B

339 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/03/04(–Ų) 15:04:38
gsub()‚Ę‚©‚ňų”‚É•Ļ”‚š—˜—p‚µ‚½‚¢‚Ģ‚Å‚·‚Ŗ‚Ē‚¤‚·‚ź‚Ī‚¢‚¢‚Ģ‚Å‚µ‚傤‚©H
gsub(str1,str2)‚Ż‚½‚¢‚ɁB

340 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/03/04(–Ų) 21:44:52
>>339
man gawk‚ę‚č
gsub(r, s [, t])
For each substring matching the regular expression r in the string t,
substitute the string s, and return the number of substitutions.
If t is not supplied, use $0. An & in the replacement text is
replaced with the text that was actually matched. Use \& to get a
literal &. (This must be typed as "\\&"; see GAWK: Effective AWK
Programming for a fuller discussion of the rules for &'s and
backslashes in the replacement text of sub(), gsub(), and gen sub().)


341 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/03/08(ŒŽ) 21:36:03
awk 'BEGIN{x="ABCDE";y="BCD";z="XXX";gsub(y,z,x);print x}'

‰½‚Ŗ“ļ‚µ‚¢‚Ģ‚©‚ę‚­‚ķ‚©‚ē‚ńB

342 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/03/17(…) 22:07:37
ŽžXawk‚¾‚Ę’x‚¢‚Ģ‚Åperl‚ɏ‘‚«Š·‚¦‚é‚Ę‚¢‚¤l‚Ŗ‚¢‚Ü‚·‚ŖA
ŽĄŪ‚Ģ‚Ę‚±‚ė‘¬‚­‚Č‚é‚ń‚Å‚µ‚傤‚©H
Ž„‚ĢŠĀ‹«‚Å‚Ķforƒ‹[ƒv‚ā‰ĮŽZ‚Č‚Ē‚Ķawk‚Ģ‚Ł‚¤‚Ŗ‘¬‚»‚¤‚Å‚·‚ŖA
‚Ē‚Ģ‚ꂤ‚ȏˆ—‚Ģź‡‚Éperl‚Ģ‚Ł‚¤‚Ŗ‘¬‚­‚Č‚č‚Ü‚·‚©H

$ time mawk 'BEGIN{x=0;for(i=1;i<=1000000;i++){x=x+i};printf("%f\n" ,x)}'
500000500000.000000

real 0m0.131s
user 0m0.120s
sys 0m0.000s
$ time gawk 'BEGIN{x=0;for(i=1;i<=1000000;i++){x=x+i};print x}'
500000500000

real 0m0.289s
user 0m0.284s
sys 0m0.000s
$ time perl -e '$x=0;for($i=1;$i<=1000000;$i++){$x=$x+$i};print $x'
500000500000
real 0m0.379s
user 0m0.376s
sys 0m0.004s


343 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/03/17(…) 22:26:14
>>342
uawk‚¾‚Ę’x‚¢‚Ģ‚Åperl‚ɏ‘‚«Š·‚¦‚é‚Ę‚¢‚¤lv ‚É•·‚Æ‚Ī•Ŗ‚©‚é

344 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/03/19(‹ą) 09:08:06
>>342
’x‚¢‚Ę‚¢‚¤awk‚Ķgawk‚Č‚Ģ?
‘f‚Ģawk‚ę‚čgawk‚Ģ•ū‚Ŗ‘‚­‚Č‚©‚Į‚½‚Į‚ƁH


345 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/03/20(“y) 01:03:01
ƒJ[ƒjƒnƒ“‚ĘƒpƒCƒN‚ĢwƒvƒƒOƒ‰ƒ~ƒ“ƒOģ–@x‚Éawk‚Ęperl
i‚ĘC‚ĘC++‚ĘJAVAj‚Ģ”äŠr‚Ŗ‚ ‚é‚Č

”‚Ģƒ}ƒVƒ“Žg‚Į‚ď‘‚«Š·‚¦‚Č‚«‚į‚Č‚ē‚Č‚¢‚Ł‚Ē’x‚¢‚Į‚Ä
‚Ē‚ń‚ȏˆ—‚Č‚ń‚¾‚ė‚¤H

346 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/03/21(“ś) 13:44:10
>342
awk “™‚š‘g‚Ż‡‚ķ‚¹‚ÄŽĄs‚·‚é‚ĘƒvƒƒZƒX‹N“®‚ĢƒRƒXƒg‚Ŗ‚©‚©‚é‚Ģ‚Å perl ‚ňź‚Ā‚É“Z‚ß‚éA‚Ę‚¢‚¤˜b‚¶‚į‚Č‚¢‚ĢH

347 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/03/22(ŒŽ) 17:35:11
•¶ŽšƒR[ƒh‚ĢƒR[ƒh‚š•Ļ”‚É‚µ‚Ä•¶Žš—ń‚š‘€ģ‚·‚邱‚Ę‚Į‚Ä‚Å‚«‚Ü‚·‚©H
•¶Žš—ń’†‚Ģ‘SŠp•¶Žš‚š”¼Šp•¶Žš‚É•Ļ‚¦‚é‰Ų—ķ‚Č•ū–@‚š–Ķõ‚µ‚Ä‚¢‚Ü‚·B

348 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/03/22(ŒŽ) 18:01:58
Use iconv.

349 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/03/22(ŒŽ) 18:25:10
> •¶ŽšƒR[ƒh‚ĢƒR[ƒh‚š•Ļ”‚É‚µ‚Ä•¶Žš—ń‚š‘€ģ‚·‚邱‚Ę‚Į‚Ä‚Å‚«‚Ü‚·‚©H

‚Č‚É‚š‚µ‚½‚¢‚Ģ‚©‚ę‚­‚ķ‚©‚ń‚Č‚¢‚ń‚¾‚Æ‚ĒB

> •¶Žš—ń’†‚Ģ‘SŠp•¶Žš‚š”¼Šp•¶Žš‚É•Ļ‚¦‚é‰Ų—ķ‚Č•ū–@‚š–Ķõ‚µ‚Ä‚¢‚Ü‚·B

‰Ų—ķ‚Č‚Ģ‚ĶtrƒRƒ}ƒ“ƒh‚šŽg‚¤•ū–@B‚½‚¾tr‚Ŗƒ}ƒ‹ƒ`ƒoƒCƒg‚š‚¤‚Ü‚­ˆµ‚Į‚Ä‚­‚ź‚é‚©
‚Ē‚¤‚©‚Ķ‚±‚±‚ė‚ą‚Ę‚Č‚¢B
Perl‚Č‚ētr‚šARuby‚Č‚ē•¶Žš—ńƒNƒ‰ƒX‚Ģtrƒƒ\ƒbƒh‚šA
Python‚Č‚ēstringƒ‚ƒWƒ…[ƒ‹‚ĢmaketransŠÖ”‚Ę•¶Žš—ń‚Ģƒƒ\ƒbƒhtranslete‚šŽg‚¤A
‚Ę‚¢‚¤Žč‚Ŗ‚ ‚éB
awk‚Č‚¢‚µitrˆČŠO‚ĢjŒĆ“T“I‚Čƒc[ƒ‹‚ʼnŲ—ķ‚É‚ā‚é•ū–@‚Ķ‚Č‚¢‚ĘŽv‚¤B

350 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/03/24(…) 17:11:16
Excel‚Å
‘SŠp”¼Šp•ĻŠ·‚Ķ ASC()
”¼Šp‘SŠp•ĻŠ·‚Ķ JIS()


351 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/03/25(–Ų) 08:34:11
>>347
1. EUC-JP‚É‚µ‚Ä(nkf‚Ę‚©)kakasi ‚ŁA–ß‚·
2. ‚»‚ź‚¾‚Į‚½‚ēÅ‰‚©‚ēAnkf -Z
3. gawk‘O’ń‚ŁA•¶Žš–ˆ‚ɏˆ—(LANG‚šŽw’肵‚ÄŽqƒvƒƒZƒX‹N“®)

awk‚Ģ’†‚Å•Ā‚¶‚Ä‚ā‚é‚Ģ‚Ķ‚ß‚ń‚Ē‚­‚³‚»‚¤

352 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/03/29(ŒŽ) 23:34:27
gawk 3.1.6
system(cmd) ‚šŽg‚¤‚ʁAƒAƒ“ƒ`ƒEƒBƒ‹ƒXƒ\ƒtƒg(kaspersky)‚Ģ
ƒAƒvƒŠƒP[ƒVƒ‡ƒ“—š—š‚Ƀoƒbƒ`ƒtƒ@ƒCƒ‹‚Ŗ“o˜^‚³‚ź‚é‚Ģ‚š”­Œ©B
close(cmd) ‚µ‚Ä‚ą“Æ‚¶B

while(cmd|getline>0){}
‚Å‘ć—p‚·‚é‚ĘŽc‚ē‚Č‚­‚Č‚Į‚½B??

353 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/13(–Ų) 00:22:57
•§‚Ńuƒ‹ƒJ”Ū’č‚ĢŒˆ‹cĢ‘š@u‘‚Ģ‰æ’lŠĻ‚Ę‘Š—e‚ź‚Č‚¢v
http://www.cnn.co.jp/world/AIC201005120004.html

ƒeƒwƒ‰ƒ“‚ŁAƒuƒ‹ƒJ‚š’…‚Ä“üo‘‚·‚鎞‚Į‚āAŠē‚Ģƒ`ƒFƒbƒN‚Ē‚¤‚·‚é‚ń‚¾‚ė‚¤B
‘¼l‚ā’j‚Å‚ą‚Ī‚ź‚Č‚¢‚ĢH

354 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/13(–Ų) 00:23:49
>>353
Œė”šƒXƒ}ƒ“

355 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/14(‹ą) 13:38:24
http://pc11.2ch.net/test/read.cgi/linux/1215431118/65

356 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/18(‰Ī) 10:51:40
awk‚Ģprint‚É‚Ā‚¢‚Ä‚²‹³Ž¦‰ŗ‚³‚¢B

‰ŗ‚Ģ‚ꂤ‚ȏo—Ķ‚Ŗ—L‚Į‚½ź‡A—į‚¦‚Ī
lrwxrwxrwx 1 root root 70 May 18 10:37 hoge

ls -al | awk '{print$1$2$2$4$6$7$8$9}' ‚Ę‚·‚ź‚Īu$5v‚Ģ
u70v‚š”²‚­‚±‚Ę‚Ŗo—ˆ‚Ü‚·‚ŖA‚±‚ź‚Ŗ$100‚Ę‚©‚Ü‚Å‘±‚­ź‡A
u$5v‚¾‚Æ‚š”²‚«‚½‚¢ź‡‹Lq‚Ŗ‘å•Ļ‚É‚Č‚č‚Ü‚·B

‰½‚©—Ē‚¢•ū–@‚Ķ–³‚¢‚ą‚Ģ‚Å‚µ‚傤‚©H

357 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/18(‰Ī) 11:01:32
$n‚É‘ć“ü‚Ŗ‚ ‚é‚ʁA‚»‚ĢŽž“_‚Å$0‚ŖÄ\¬‚³‚ź‚éB

‹ęŲ‚č‚Ģ‹ó”’‚Ŗ$5‚Ģ‚ ‚Į‚½‚Ę‚±‚ė‚¾‚Æ2ŒĀ‚É‚Č‚é‚Ģ‚Ŗ‹C‚É‚Č‚ē‚Č‚Æ‚ź‚ĪA
ls -al | awk '{$5 = ""; print}'
‚Ę‚·‚ź‚Ī‚ę‚¢B

‹ó”’2ŒĀ‚šC³‚·‚é‚Č‚ē‚±‚¤‚·‚éB
ls -al | awk '{$5 = ""; print $0}' | awk '{$1 = $1; print}'

358 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/18(‰Ī) 11:03:15
$0 ‚Ķ—]Œv‚¾‚Į‚½B
ls -al | awk '{$5 = ""; print}' | awk '{$1 = $1; print}'

359 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/18(‰Ī) 11:07:03
2‚Ā‚ß‚Ģawk‚Ģ$1 = $1‚Ķ‰½‚Ģ‚½‚ß?

360 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/18(‰Ī) 11:34:06
‚Č‚É‚ą‚µ‚Č‚¢‚ʁA$0‚Ķ“Ē‚Żž‚ń‚¾‚»‚Ģ‚Ü‚Ü‚Č‚Ģ‚Å‹ó”’2ŒĀ‚Ķ‹ó”’2ŒĀ‚Ģ‚܂܁B
$1=$1‚Å‘ć“ü‚µ‚Ä‚ā‚é‚ʁA$1, $2, ...‚š‹ó”’1ŒĀ‚Å‚Ā‚Č‚¢‚¾‚ą‚Ģ‚Ŗ$0‚É‘ć“ü‚³‚ź‚é‚Ģ‚ŁA
‹ó”’2ŒĀ‚¾‚Į‚½‚Ę‚±‚ė‚Ŗ‹ó”’1ŒĀ‚É‚Č‚éB

361 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/18(‰Ī) 11:35:04
2‚Ā‚ß‚Ģawk‚ɐH‚ķ‚¹‚½Žž“_‚Å$n (n>0)‚Ķ‹l‚Ü‚é‚Æ‚Ē$0‚Ķ“ü—Ķs‚»‚Ģ‚Ü‚Ü
‹ó”’2ŒĀ‚Č‚Ģ‚Å$0‚šÄ\¬‚·‚é‚Ę‹ó”’1ŒĀ‹ęŲ‚č‚É‚Č‚é

362 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/18(‰Ī) 12:21:12
>>357-358
”ńķ‚ɉš‚č‚ā‚·‚¢‚²ą–¾A‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B
‚Č‚é‚Ł‚Ē‘ć“ü‚·‚邱‚Ę‚Å‰šŒˆ‚·‚é‚ń‚Å‚·‚ĖB
•×‹­‚É‚Č‚č‚Ü‚µ‚½B

363 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/18(‰Ī) 15:08:38
$1 = $1 ‚Į‚ăCƒ}ƒCƒ`‚ę‚­‰š‚ē‚ń

$1‚Į‚ÄFS‚Å‹ęŲ‚ē‚ź‚½ˆź‚Ā–Ś‚¾‚ę‚ĖH
‚Č‚ń‚Å‚»‚źŽ©g‚šŽ©•Ŗ‚É‘ć“ü‚µ‚½‚ēƒXƒy[ƒX‚ŖĮ‚¦‚é‚ńH

364 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/18(‰Ī) 15:27:35
$0‚ĢÄ\¬‚Ŗs‚ķ‚ź‚é‚©‚ē‚Į‚Đą–¾‚³‚ź‚Ă邾‚ėB

$0‚ĢÄ\¬‚Ę‚Ķ‚¢‚Į‚½‚ń‚Ī‚ē‚µ‚½$1,$2,...‚šOFS‚š‹²‚ń‚Å
‚Ā‚Č‚°’¼‚·‚Į‚Ä‚±‚Ę‚Č‚Ģ‚ŁA‰½‚Å‹ęŲ‚ē‚ź‚Ä‚¢‚½‚©‚Ķ
•Ū‘¶‚³‚ź‚Č‚¢B

365 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/18(‰Ī) 15:41:56
>>364
>$1=$1‚Å‘ć“ü‚µ‚Ä‚ā‚é‚ʁA$1, $2, ...‚š‹ó”’1ŒĀ‚Å‚Ā‚Č‚¢‚¾‚ą‚Ģ‚Ŗ$0‚É‘ć“ü‚³‚ź‚é

‚Į‚Ä–ń‘©Ž–‚šŠo‚¦‚Ä‚Ø‚Æ‚Į‚Ä‚±‚Ę‚©‚¢H

366 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/18(‰Ī) 15:42:39
‚æ‚å‚Į‚Ę‹C‚É‚Č‚Į‚ÄŽŽ‚µ‚Ä‚Ż‚½B

% echo a b | gawk '{OFS="-";$1=$1;OFS="=";print}'
a=b

Ä\¬‚Ķ$1=$1‚š‚ā‚Į‚Ä‚·‚®‚¶‚į‚Č‚­‚āAŽŸ‚É$0‚ŖŽg‚ķ‚ź‚é‚Ę‚«A‚Į‚Ä‚±‚Ę
‚Č‚Ģ‚©‚Č?

367 F365F2010/05/18(‰Ī) 16:27:59
‰š‚Į‚½

http://www.kt.rim.or.jp/~kbk/gawk-3.1/gawk.html

Œx: ˆź•”‚Ģƒo[ƒWƒ‡ƒ“‚Ģawk‚Ķ NF‚šŒø‚¶‚½‚Ę‚«‚É$0‚ĢÄ\’z‚šs‚ķ‚Č‚¢B
Œ‹‹Ē‚Ģ‚Ę‚±‚ėAawk‚ɃŒƒR[ƒh‘S‘Ģ‚ĢÄ\’z‚š‹­§‚µ‚½‚Ę‚«‚É‚Ķ‚»‚ĢŽž“_‚Å
ƒtƒB[ƒ‹ƒh‚Ģ’l‚ĘOFS‚ŖŽg‚ķ‚ź‚éBÄ\’z‚šs‚¤‚½‚ß‚É‚ĶA‰½‚ē‚©‚Ģ–³ŠQ‚Č
‘ć“ü‚šs‚¤:

$1 = $1 # force record to be reconstituted


Œ«‚­‚Č‚Į‚½B‚ ‚ń‚Ŗ‚ʁB

368 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/18(‰Ī) 16:46:58
awk‚Ķšś‚Ŗ[‚¢‚Ģ‚§

369 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/19(…) 22:24:52
‹v‚µ‚Ō‚č‚É‚¢‚¢‚ą‚ń‚šŒ©‚³‚¹‚Ä‚ą‚ē‚¢‚Ü‚·‚½„ƒ


370 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/24(ŒŽ) 09:55:14
’m‚ē‚Č‚©‚Į‚½B
•×‹­‚É‚Č‚Į‚½B

371 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/24(ŒŽ) 15:25:46
‚Ż‚ń‚Č>357‚Ģ‚؈ü‚Å‘½‚­‚šŠw‚ń‚¾‚ȁB

372 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/05/29(“y) 04:53:07
–¼‘OF
E-mailF
“ą—eF
cygwin‚¾‚Ę
% cut -f1 -d, hoge.csv
‚ę‚č
% awk -F, '{print $1}' hoge.csv
‚Ģ•ū‚Ŗ‘¬‚©‚Į‚½B
#ŽĄsŽžŠŌ‚Ė
#PerlHƒVƒ‰ƒl


373 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/06/07(ŒŽ) 11:45:38
>>372
sed -e 's/,.*//'‚Å‚ąawk‚Ę“Æ‚¶‚­‚ē‚¢‚¾‚©‚ēAcut‚ĢŽĄ‘•‚Ŗ’x‚¢‚ń‚¾‚ĖB
cut‚Ŗ–³‘Ź‚ɃIƒvƒVƒ‡ƒ“‘½‚¢Šˆ×‚¶‚į‚Č‚¢?

374 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/06/07(ŒŽ) 12:04:05
ŽčŒ³‚ĢlinuxŠĀ‹«‚¾‚Ęcut‚Ģ•ū‚Ŗ‘¬‚¢‚Ę‚¢‚¤•’Ź‚ĢŒ‹‰Ź‚Å‚µ‚½‚ŖB
hoge.csv‚Ķ6Œ…‚Ģ—”3‚Ā‚šu,]‚Å‹ęŲ‚Į‚Ä•Ą‚ׂ½100–œs‚Ģ
ƒtƒ@ƒCƒ‹‚Å‚·B

% time cut -f1 -d, hoge.csv >/dev/null
cut -f1 -d, hoge.csv > /dev/null 0.21s user 0.01s system 99% cpu 0.222 total
% time awk -F, '{print $1}' hoge.csv >/dev/nulll
awk -F, '{print $1}' hoge.csv > /dev/nulll 1.52s user 0.03s system 99% cpu 1.558 total

‚æ‚Č‚Ż‚Ƀo[ƒWƒ‡ƒ“‚Ķ

cut (GNU coreutils) 8.5
GNU Awk 3.1.7

375 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/06/07(ŒŽ) 12:22:48
‚ [‚Č‚é‚Ł‚ĒA‚Č‚ń‚©”»‚Į‚½Bcygwin‚Ģfgetc()‚Ŗ’x‚¢‚©‚ē‚¶‚į‚Č‚¢‚©‚ȁB
fgetc()‚Ęfgets()‚ÅŽžŠŌ‚šŠr‚ׂ½‚Ę‚«‚Éfgetc()‚Ģ•ū‚Ŗ‚ø‚Į‚Ę’x‚©‚Į‚½‹L‰Æ‚Ŗ‚ ‚éB

376 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/09/13(ŒŽ) 14:14:54
xgawk (gawk‚Å‚Č‚­)‚É‚Ę‚ ‚éwebƒy[ƒW‚šH‚ׂ³‚¹‚é‚ʁAXMLERRR (not well-formed)‚Å’†’f‚µ‚Ü‚·B
‚»‚Ģƒy[ƒW‚Ŗwell-formed‚©‹Éˆ«‚©‚ĶŽ„‚É‚Ę‚Į‚Ä‚Ē‚¤‚Å‚ą‚ę‚­A’P‚É“ą—e‚š“¾‚½‚¢‚¾‚Æ‚Č‚Ģ‚ŁA•¶––‚܂ŏˆ—‚µI‚¦‚Ä—~‚µ‚¢‚Ģ‚Å‚·B
‚Ē‚¤‚É‚©‚Č‚ē‚Č‚¢‚Å‚µ‚傤‚©B

377 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/09/25(“y) 14:55:22
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg“ą‚ŃpƒCƒv“ü—Ķ‚³‚ź‚½‚ą‚Ģ‚šˆ—‚·‚é
ƒAƒNƒVƒ‡ƒ“‚šƒqƒAƒhƒLƒ…ƒƒ“ƒg‚ŏ‘‚­Ž–‚Ķo—ˆ‚é‚Å‚µ‚傤‚©B


378 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/09/27(ŒŽ) 14:57:18
Žæ–ā‚Å‚·B
ƒf[ƒ^‚Ŗ
|1|aaa|
|2|bbb|
|3|ccc|
‚Č‚Ē‚Ę‚Č‚Į‚Ä‚¢‚é‚Ę‚«
aaa
bbb
ccc
‚šŽę‚čo‚»‚¤‚Ę‚µ‚Ä
awk 'FS="|"{print $3}' ƒtƒ@ƒCƒ‹–¼
‚Ę‚µ‚½‚ń‚Å‚·‚ŖA1s–Ś‚¾‚Æ‚Ŗ‚¤‚Ü‚­‚Ę‚ź‚Ü‚¹‚ńB
ƒf[ƒ^ƒtƒ@ƒCƒ‹‚Ģ1s–Ś‚š‹ós‚É‚·‚ź‚Ī‰šŒˆ‚Å‚«‚Č‚¢‚±‚Ę‚Ķ‚Č‚¢‚ń‚Å‚·‚ŖA
‹ós‚š“ü‚ź–Y‚ź‚Ä‚µ‚Ü‚¤Œœ”O‚Ŗ‚ ‚č‚Ü‚·B
‚Ē‚¤‚·‚ź‚Ī‚¢‚¢‚ń‚Å‚µ‚傤‚©?

379 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/09/27(ŒŽ) 15:01:46
‚ā‚č‚½‚¢‚±‚Ę‚Ķ awk 'BEGIN {FS="|"} {print $3}' ‚¶‚į‚Č‚¢‚©‚ĘŽv‚¤‚ń‚¾‚Æ‚Ē

380 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/09/27(ŒŽ) 15:08:38
378‚Å‚·B
>>379
‚Ē‚¤‚ą‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚µ‚½B

381 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/09/27(ŒŽ) 18:42:12
gensub()‚ɂāAƒ}ƒbƒ`‚µ‚½10”Ō–ŚˆČ~‚ĢƒOƒ‹[ƒv‚ĢŽw’č‚ĢŽd•ū‚š‹³‚¦‚Ä‚­‚¾‚³‚¢B
‰ŗ‹LƒTƒCƒg‚Å‚ĶA17”Ō–Ś‚Ü‚Å•’Ź‚ÉŽw’č‚Å‚«‚é‚ꂤ‚ČŽ–‚Ŗ‘‚¢‚Ä‚ ‚é‚Æ‚ĒA
http://tounderlinedk.blogspot.com/2010/08/gensub-n-awk.html

gensub(pattern,"\\10","g",$2) ‚Ę‚©‚­‚Ę
\\1(ƒ}ƒbƒ`‰ÓŠ)‚Ę0(•¶Žš)‚Ę‚µ‚ĉšŽß‚³‚ź‚æ‚į‚Į‚ďćŽč‚­‚¢‚Č‚©‚¢B

ƒVƒFƒ‹ƒXƒNƒŠƒvƒg•—‚©‚ĘŽv‚Į‚āA\\{10} ‚ąŽŽ‚µ‚½‚Æ‚Ēƒ_ƒƒ_ƒbƒ^[B

GNU Awk 3.1.5‚Å‚·B


382 F381F2010/09/27(ŒŽ) 19:00:47
BSD‚Ģjman‚É‚ĶA1‚©‚ē9‚Ü‚Å‚Ģ”Žš‚Į‚Ä–¾‹L‚³‚ź‚Ä‚é‚Č‚ B
ŽĄ‘•‚É‚ę‚Į‚Ĉį‚¤‚Ģ‚©‚Č‚ 
ƒpƒ^[ƒ“‚š“®“I‚ɐ¶¬‚µ‚ă}ƒbƒ`‚³‚¹‚ꂤ‚Ę‚µ‚Ä‚é‚©‚ēŒ‹\¢‚é(LEƒÖE`)
http://www.linux.or.jp/JM/html/GNU_gawk/man1/gawk.1.html


383 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/09/27(ŒŽ) 19:04:47
>>381
ƒ}ƒjƒ…ƒAƒ‹‚É‚Ķ1‚©‚ē9‚Ü‚Å‚Į‚ď‘‚¢‚Ä‚ ‚邵

Within the replacement text s, the sequence \n, where n is a digit from 1 to 9, may be
used to indicate just the text that matched the n'th parenthesized subexpression.

ƒ\[ƒX‚ĢŠY“–‰ÓŠ(builtin.c‚Ģ2542s–Ś‚ ‚½‚č‚©‚ē)‚Ż‚Ä‚ą1Œ…ŒĄ’č‚ĢƒƒWƒbƒN‚¾‚ęB(3.1.7’²‚×)

int dig = scan[1] - '0';

‚Č‚ń‚Ä‚ā‚Į‚Ä‚éB

384 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/09/27(ŒŽ) 19:08:03
ˆź’U‚Ō‚Į‚½Ų‚邵‚©‚Č‚¢‚ń‚¶‚į‚Ė

385 F381F2010/09/27(ŒŽ) 19:12:31
>>383
‚Ē‚¤‚ą‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B

>>384
‚æ‚å‚Į‚ĘŒ©‰h‚¦ˆ«‚­‚Č‚é‚Æ‚Ē‚»‚¤‚·‚é(LEƒÖE`)

386 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/09/27(ŒŽ) 21:27:29
>>381
‚Č‚ń‚Å‚»‚±‚Ģ‚Š‚Ę‚Ķ16‚Ü‚Å‚Å‚«‚½‚ń‚¾H

387 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/09/28(‰Ī) 00:32:52
10‚Ģ‘ć‚ķ‚č‚É:‚šŽg‚Į‚Ä‚¢‚½‚肵‚āB

388 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/09/28(‰Ī) 03:15:24
‚±‚ĢƒXƒŒ‚Ŗ·‹µ‚Č‚Ģ‚Ŗ’悵‚¢‚©‚ē
‹L”OƒpƒsƒRB

389 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/09/28(‰Ī) 03:41:50
15”NˆČć‘O‚¾‚Æ‚Ēawk‚Ģ•×‹­Žn‚ß‚Ä“ÆŽž‚Éperl‚Ģ•×‹­‚ą‚µ‚Ä‚½‚ē
‹C•t‚¢‚½‚ēperl‚Ī‚Į‚©‚č‚ā‚Į‚Ä‚Äawk‚·‚Į‚©‚č–Y‚ź‚Ä‚µ‚Ü‚Į‚½‚Č‚Ÿ
”‚ĶperlŽĢ‚ĂĐź‚ēpython‚ā‚Į‚Ä‚é‚Æ‚Ēawk‚ą‚¢‚¢‚ę‚Ė

390 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/09/28(‰Ī) 09:40:13
Busybox‚É‘g‚Żž‚ß‚ĪA‚»‚ź‚±‚»†”ŃŠķ‚ā—ā‘ ŒÉ‚Å‚ą“®‚­‚©‚ē‚Č‚ B
ŽčŒy‚Å‚ ‚é‚É‚ąŠÖ‚ķ‚ē‚øAŒ‹\‚“x‚ȏˆ—‚ąƒKƒŠƒKƒŠ‘‚Æ‚é‚©‚ēD‚«B

C‚ĘƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚ŖD‚«‚¾‚©‚ēA•¶–@“I‚É‚ą‚µ‚Į‚­‚č—ˆ‚éB
ćˆŹŒŻŠ·‚ĢPerl‚ą‘åD‚«B

391 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/09/28(‰Ī) 14:37:59
>>376‚Å‚·‚ŖA’N‚ą‚©‚Ü‚Į‚Ä‚­‚ź‚Č‚¢‚Ģ‚ÅŽā‚µ‚³‚ÅŽ€‚É‚»‚¤‚Å‚·B

392 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/09/28(‰Ī) 14:52:08
>>391
‚Ē‚ź‚Å‚ąD‚«‚Č‚Ģ‚š‘I‚×

1. xgawk‚š‰ü‘¢
2. ƒGƒ‰[‚É‚Č‚éXML‚šŽ–‘O‚ɏC³‚µ‚Äwell-formed‚É‚µ‚Ä‚©‚ēH‚ķ‚¹‚é
3. xgawk‚ĶŽĢ‚Ä‚Ä•Ź‚ĢŒ¾ŒźAƒ‰ƒCƒuƒ‰ƒŠ‚šŽŽ‚·

393 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/09/28(‰Ī) 17:23:08
jawk‚Ŗjwalk‚ÉŒ©‚¦‚Ä‚µ‚Ü‚¤

394 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/10/01(‹ą) 11:21:26
“®‚­ŠĀ‹«‚Ģ‘½‚³‡‚ɃCƒ“ƒ^ƒvƒŠƒ^‚š‘I‚Ō‚ń‚Č‚ēA

ƒVƒFƒ‹ƒXƒNƒŠƒvƒg > awk >>> perl >>>>> python >>>>> ruby >>> haskel etc.

‚Ę‚Č‚é‚¾‚ė‚¤‚ȁB

ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚ĶƒVƒFƒ‹ˆĖ‘¶‚Č•”•Ŗ‚Ŗ‘½‚­Aperl ‚Ł‚Ē‚‹@”\‚Č‚ą‚Ģ‚ą—v‚ē‚Č‚¢B
‚»‚ń‚ČŽžA¬‚³‚Č’[––‚Å‚ąƒXƒ}[ƒg‚É“®‚¢‚Ä‚­‚ź‚é awk ‚É‚æ‚ń‚±–u‚ĀB

>>389
Œ¾Œź‚ÉŽĢ‚Ä‚é‚ąE‚¤‚ą‚Č‚¢‚ęB‚»‚ĢŽžX‚É“s‡‚Ģ—Ē‚¢‚ą‚Ģ‚š‘g‚Ż‡‚ķ‚¹‚ÄŽg‚¤‚Ģ‚ŖUNIX“I‚Č”­‘zB

395 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/10/01(‹ą) 15:33:40
>>394
uˆź”­‚ā‚ė‚¤v‚Å‚·‚ĖI

396 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/10/09(“y) 04:40:48
awkÅ‹ß•×‹­‚µ‚Ä‚éBperl‚ę‚č‘S‘RŠČ’PB
‚±‚ź‚Č‚ē‰“‚Å‚ąĮÜ‚µ‚Č‚­‚Ä‚·‚Ż‚»‚¤

397 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/10/09(“y) 04:57:14
>>396@‚Ŗ‚ń‚ĪI

398 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/10/21(–Ų) 20:16:46
sjis‚ŏ‘‚¢‚½
/[/{print}
‚šŽĄs‚·‚é‚Ę

awk:
awk: ^ ³‹K•\Œ»‚ŖI’[‚³‚ź‚Ä‚¢‚Ü‚¹‚ńB
awk: ’v–½“I: [ ‚Ü‚½‚Ķ [^ ‚Ŗ‘Ī‰ž‚µ‚Ü‚¹‚ńB: /[/{print}/

‚ĢƒGƒ‰[‚É‚Č‚Į‚Ä‚µ‚Ü‚¢‚Ü‚·B
[‚Ģ2ƒoƒCƒg–Ś‚Ŗ[‚Č‚¹‚¢‚¾‚ĘŽv‚¢‚Ü‚·‚ŖA‚Ē‚¤‘Ī‰ž‚µ‚½‚ē‚¢‚¢‚Å‚µ‚傤‚©H
“ü—Ķƒtƒ@ƒCƒ‹‚Ķsjis‚ŏ‘‚©‚ź‚Ä‚¢‚āA•¶ŽšƒR[ƒh•ĻŠ·‚Ķ‚Å‚«‚Ü‚¹‚ńB


399 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/10/21(–Ų) 20:55:41
>>398
ŠĀ‹«‚Ģ–ā‘č‚Č‚ń‚¾‚©‚ēAŽĄsŠĀ‹«‚­‚ē‚¢‚Ü‚Ę‚ą‚ɏ‘‚Æ‚ęB

400 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/10/21(–Ų) 21:38:24
>>398
gawk ‚šŽg‚¤

401 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/10/21(–Ų) 22:52:57
ŠĀ‹«‚ĶCentOS-5.5-x86_64‚ÅGNU Awk 3.1.5‚Å‚·B
/bin/awk‚ĶƒVƒ“ƒ{ƒŠƒbƒNƒŠƒ“ƒN‚ŁAŽĄ‘Ģ‚Ķgawk‚Å‚µ‚½B

402 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/10/21(–Ų) 23:49:35
>>401
--help ‰Å

403 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/10/22(‹ą) 01:41:07
Windows‚V(64bit)‚ÅŽg‚¦‚éawk‚ ‚č‚Ü‚·‚©H


404 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/10/22(‹ą) 02:19:30
32bit”Å‚Ģawk‚š‚šŽg‚¤‚ń‚¶‚įƒ_ƒH

405 F398F2010/10/22(‹ą) 07:32:34
‚±‚¤‚·‚邱‚Ę‚Å‘Ī‰ž‚Å‚«‚Ü‚µ‚½B
/\x81\[/{print}

406 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/10/22(‹ą) 09:41:36
‚»‚ź‚Å‚¢‚¢‚Č‚ēA/[[]/‚Å‚ą‚¢‚¢ŠóƒKƒXB
Ŗ–{“I‚ȉšŒˆ‚É‚Č‚Į‚Ä‚Č‚¢‚Æ‚Ē‚Ė‚„B

407 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/10/22(‹ą) 13:52:10
ƒVƒ“ƒOƒ‹ƒNƒI[ƒe[ƒVƒ‡ƒ“‚āƒ_ƒuƒ‹ƒNƒI[ƒe[ƒVƒ‡ƒ“‚ĢŽg‚¢•Ŗ‚Æ‚¶‚į‚Ė`

408 F398F2010/10/22(‹ą) 19:55:53
Ŗ–{“I‚ȉšŒˆ‚·‚é‚Ę‚µ‚½‚ē•¶ŽšƒR[ƒh‚š•Ļ‚¦‚邱‚Ę‚Å‚µ‚傤‚©H


409 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/10/22(‹ą) 20:03:18
“ś–{Œź‚Ģ•¶ŽšƒR[ƒh‚É‘Ī‰ž‚µ‚Ä‚éawk‚šŽg‚¤A‚Ę‚¢‚¤•ū–@‚ą‚ ‚éB
”‚ ‚é‚Ģ‚©‚Ē‚¤‚©’m‚ē‚Č‚¢‚Æ‚ĒB

410 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/10/22(‹ą) 20:28:38
”‚Ģgawk‚Ķ•’Ź‚ÉUnicode‘Ī‰ž‚µ‚Ä‚é‚Ż‚½‚¢

$ echo '‚Ä‚·‚Ę' | gawk '/[‚Ÿ-‚ń]/ { print length($0) }'
3

UTF-8ƒƒP[ƒ‹‚Å‚µ‚©ŽŽ‚µ‚Ä‚Č‚¢‚Æ‚Ē
cygwin‚Å‚ą‘åä•v

411 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/10/23(“y) 01:29:00
>>404
gawk‚Å‚¢‚¢‚©‚Č

412 F399F2010/10/23(“y) 06:55:10
>>405

–ā‘č‚Ķ‰šŒˆ‚µ‚½‚Ģ‚©‚ą‚µ‚ē‚ń‚ŖAˆź‰žB
ˆČ‰ŗ2‚Ā‚ĢWin—pƒoƒCƒiƒŠ‚Ķ–ā‘č‚Č‚¢‚Ģ‚ŁAƒ\[ƒX‚ą‚ē‚Į‚ÄLinuxć‚ŃRƒ“ƒpƒCƒ‹‚µ‚Ä‚Ż‚½‚ēH

ttp://gnuwin32.sourceforge.net/packages/gawk.htm
ttp://www.kt.rim.or.jp/~kbk/gawk-3.1/


413 F398F2010/10/23(“y) 10:53:14
ƒT[ƒoŠĒ—ŽŅ‚¶‚į‚Č‚¢‚Ģ‚ŃT[ƒo‚š‚¢‚¶‚邱‚Ę‚Ķ‚Å‚«‚Č‚¢‚Å‚·B
‚±‚ź‚É‚µ‚½‚ēsjis‚Å‚ą“®‚­‚ꂤ‚É‚Č‚é‚Ģ‚Å‚µ‚傤‚©H

414 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/10/23(“y) 12:27:19
>>413
­‚Č‚­‚Ę‚ąŽ©•Ŗ‚ŖŽŽ‚µ‚½Windows2003ć‚Å‚Ķ‚ȁB

¤tes.awk ¦sjis
/[/{print}
¢

CentOS5.5ć
$ gawk -f tes.awk readme.ja
awk: tes.awk:1:
awk: tes.awk:1: ^ ³‹K•\Œ»‚ŖI’[‚³‚ź‚Ä‚¢‚Ü‚¹‚ńB
awk: tes.awk:1: ’v–½“I: [ ‚Ü‚½‚Ķ [^ ‚Ŗ‘Ī‰ž‚µ‚Ü‚¹‚ńB: /[/{print}/

Windows2003ć
> gawk -f tes.awk readme.ja
Ėƒ}ƒbƒ`‚µ‚½•Ø‚Ŗ•\Ž¦‚³‚ź‚é

Linuxć‚эƒP[ƒ‹‚šsjis.japanese‚Ę‚©‚É‚·‚ź‚Ī‚¢‚¢‚Ģ‚©‚ĘŽv‚Į‚½‚ŖAƒƒP[ƒ‹•ĻXŽ©‘Ģ‚Ŗ‚¤‚Ü‚­‚¢‚©‚Č‚©‚Į‚½‚ķB
¢‚Į‚Ă鎖‚Ŗ‚ ‚é‚Č‚ēAÅI“I‚ɉ½‚Ŗ‚µ‚½‚¢‚©Œ¾‚Į‚½‚Ł‚¤‚Ŗ‚¢‚¢‚ęB

415 F398F2010/10/23(“y) 12:40:31
Windows2003‚¾‚Ę‚æ‚į‚ń‚Ę“®‚­‚ń‚Å‚·‚ĖB
¢‚Į‚Ä‚¢‚½‚±‚Ę‚Ķ405‚ʼnšŒˆ‚µ‚½‚Ģ‚Å‘åä•v‚Å‚·B
”‚ĶuŖ–{“I‚ȉšŒˆv‚É‹»–”‚Ŗ‚ ‚Į‚½‚Ģ‚Å‚Ø•·‚«‚µ‚½ŽŸ‘ę‚Å‚·B

416 F‰SŽŅF2010/11/04(–Ų) 22:14:10
awk‚ŃVƒFƒ‹‚ĢPATH•Ļ”‚šƒ}ƒbƒ`‚³‚¹‚é‚Ę‚«‚ɃXƒ‰ƒbƒVƒ…//‚šŽg‚ķ‚Č‚¢•ū–@‚š‹³‚¦‚Ä‚¢‚½‚¾‚Æ‚Ü‚¹‚ń‚©H

417 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/11/04(–Ų) 23:14:10
>>416
‰SŽŅ‚¾‚©‚ēƒ}ƒ‹ƒ`‚Ŗ‹–‚³‚ź‚é‚Ę‚Å‚ąŽv‚Į‚½‚©H

418 F‰SŽŅF2010/11/05(‹ą) 06:32:09
‚²‚ß‚ń‚Č‚³‚¢I
’m‚č‚Ü‚¹‚ń‚Å‚µ‚½B

419 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/12/15(…) 01:54:35
”z—ń‚Ģ—v‘f”‚š’²‚ׂé‚Č‚ēAƒ‹[ƒvˆ—‚µ‚Č‚¢‚Ę•Ŗ‚©‚ē‚Č‚¢H
length ‚Ż‚½‚¢‚Č‚Ģ‚Ķ–³‚¢H

420 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/12/15(…) 02:27:50
‚ ‚é‚ęB‚Ü‚³‚µ‚­Alength(array)B

421 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/12/15(…) 02:42:46
‚»‚ń‚Č‚ą‚ń‚Ė‚„‚ę‚—
‚ĘŽv‚Į‚½‚ēgawk‚É‚Ķ‚ ‚é‚Ģ‚©

length([s]) Returns the length of the string s, or the
length of $0 if s is not supplied. Starting
with version 3.1.5, as a non-standard exten-
sion, with an array argument, length() returns
the number of elements in the array.

422 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/12/15(…) 04:20:37
‚Ž‚µ‚ė”z—ń‚Ŗ‘¶Ż‚·‚é‚Į‚Ä‚±‚Ę‚Ķ‚»‚Ģ”z—ń‚šģ¬‚·‚é‰ß’ö‚Ŗ‚ ‚邾‚ėH
ģ¬‚·‚é‚Ę‚«‚ɐ”‚¦‚ź‚Ī‚¢‚¢‚ń‚¶‚į‚ĖH

423 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/12/15(…) 08:40:15
˜A‘z”z—ń‚¾‚Į‚½‚ē”‚¦‚Č‚¢‚Ģ‚Ŗ•’Ź‚¾‚Ŗ‚Č

424 F419F2010/12/25(“y) 03:12:23
function ‚ŏˆ—‚·‚鎞A”z—ń‚¾‚Æ‚Å‚Ķƒ_ƒ‚Å—v‘f”‚Ü‚Å•K—v‚Č‚ń‚¾‚©‚Č‚ŸA
‚Į‚ÄŽ–‚Ŗ•Ŗ‚©‚č‚Ü‚·‚½

425 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/12/28(‰Ī) 11:29:35
function ‚É“n‚·‚¾‚Æ‚Č‚ē—v‘f”‚Č‚ń‚Ä‚¢‚ē‚Č‚¢‚ń‚¶‚į‚Č‚¢H


426 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/12/28(‰Ī) 13:55:13
$1 = $1‚Ż‚½‚¢‚ČƒgƒŠƒbƒN‚šŒ©‚é“x‚ɉœ‚Ŗ[‚¢‚ĘŒ¾‚¤‚ę‚č‚Ķ•³‚ÉŒ©‚¦‚Ä‚«‚Ü‚·
–|‚·‚ĘUNIX•¶‰»‚»‚Ģ‚ą‚Ģ‚Ŗ
‚Ü‚ A‚ ‚­‚Ü‚Å‚Ø‚ź‚ĢŽåŠĻ‚Å‚·‚Ŗ‚Ė

427 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/12/28(‰Ī) 15:24:21
>>426
‚‚—‚‹‘åD‚«‚ČƒIƒCƒ‰‚ÉŒ–‰Ü”„‚é‚Ģ‚©‚—
ƒEƒjƒbƒNƒX•¶‰»Å‚Ii‚m‚sŒn‚Ķ‚t‚m‚h‚w‚ĢƒpƒNƒŠj

428 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2010/12/28(‰Ī) 15:28:13
>>427
‘SŠp‰pŽšŽg‚¤“z‚Ŗ awk ‘åD‚«‚¾‚Ę‚Ķ“ž’źŽv‚¦‚ń

429 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/05(…) 23:22:55
‚Ü‚ “~‹x‚ŻŠśŠŌ‚¾‚ą‚Ģ‚ĖB

430 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/06(–Ų) 00:22:04
„tes09.awk
BEGIN{
@@if (ARGV[1]=="")
@@@@ARGV[1]="hoge.txt"
@@while (getline < ARGV[1] > 0) print "BEGIN\t"$0
}
ARGV[1]=="hoge.txt"{
@@print "BODY\t"$0
}

šŽæ–ā
ć‹LƒXƒNƒŠƒvƒg‚šˆų”‚š•t‚Æ‚½ź‡‚Ę•t‚Æ‚Č‚¢ź‡‚š‚»‚ź‚¼‚źŽĄs‚µ‚Ü‚µ‚½B

„gawk -f tes09.awk hoge.txt
BEGIN@ arima_yuuichi@example.com
BEGIN@ ooizumi_sadawo@example.com
BEGIN@ taguchi_kenji@example.com
BODY@@arima_yuuichi@example.com
BODY@@ooizumi_sadawo@example.com
BODY@@taguchi_kenji@example.com

„gawk -f tes09.awk
BEGIN@ arima_yuuichi@example.com
BEGIN@ ooizumi_sadawo@example.com
BEGIN@ taguchi_kenji@example.com

‚±‚±‚ŁABEGIN‹å‚Å‚Ģ ARGV[1]="hoge.txt" ‚Ę‚¢‚¤‘ć“ü‚š–{•Ņ(?)‚Å‚ą—LŒų‚É‚·‚éˆ×
‚É‚Ķ‚Ē‚¤‚·‚ź‚Ī‚¢‚¢‚Å‚µ‚傤‚©H

431 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/06(–Ų) 00:31:45
‚Č‚É‚ą‚µ‚Č‚­‚Ä‚ą—LŒų‚¾‚ĘŽv‚¤‚ń‚¾‚Æ‚Ē
Žæ–ā‚ĢŽļŽ|‚Ŗ‚ķ‚©‚ē‚ń

432 F430F2011/01/06(–Ų) 06:20:53
•Ŗ‚©‚čh‚­‚Ä‚·‚Ż‚Ü‚¹‚ńB
hoge.txt‚Ģ’†g‚Ķ‰ŗ‹L‚Å‚·B
„
arima_yuuichi@example.com
ooizumi_sadawo@example.com
taguchi_kenji@example.com

>>430‚ĶWin32‚ĢƒoƒCƒiƒŠuGNU Awk 3.1.7(windows special Nov 24 2009)v‚šŽg—p‚µ‚½Œ‹‰Ź‚Å‚·B
‰ŗ‚Ģ‚Ł‚¤‚ĢŽĄsŒ‹‰Ź‚Å‚ĶABEGIN‹å‚Å‚ĢARGV[1]‚Ö‚Ģ‘ć“ü‚ĶBEGIN‹å‚Å‚Ķ—LŒų‚Å‚·‚ŖA
–{•Ņ‚Å‚Ķ—LŒų‚É‚Č‚Į‚Ä‚¢‚Č‚¢‚Ģ‚ŏo—Ķ‚³‚ź‚Ä‚¢‚Č‚¢‚ꂤ‚ÉŒ©‚¦‚Ü‚·B

‚æ‚Č‚Ż‚ɁACentOS5.5ć‚Ģ GNU Awk 3.1.5 ‚Å‚Ķ‰ŗ‹LƒGƒ‰[‚É‚Č‚č‚Ü‚µ‚½B

„
gawk: tes09.awk:2: @@if (ARGV[1]=="")
gawk: tes09.awk:2: ^ •\Œ»‚Ģ char 'E' ‚Ķ•s³‚Å‚·B

433 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/06(–Ų) 08:57:49
“ü—ĶƒŒƒR[ƒh‚Ŗ1Œ‚ą–³‚¢‚©‚ē‚Å‚µ‚å

>gawk: tes09.awk:2: ^ •\Œ»‚Ģ char 'E' ‚Ķ•s³‚Å‚·B
‚±‚ź‚Ķ‘SŠpƒXƒy[ƒX

434 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/06(–Ų) 09:12:00
>BEGIN@ arima_yuuichi@example.com
>BEGIN@ ooizumi_sadawo@example.com
>BEGIN@ taguchi_kenji@example.com
ƒRƒŒ‚Ķgetline‚Å“Ē‚ń‚ŏo—Ķ‚µ‚½‚ą‚Ģ

>BODY@@arima_yuuichi@example.com
>BODY@@ooizumi_sadawo@example.com
>BODY@@taguchi_kenji@example.com
ƒRƒŒ‚ĶƒRƒ}ƒ“ƒh‚ÅŽw’肵‚½ƒtƒ@ƒCƒ‹‚©‚ēo—Ķ‚µ‚½‚ą‚Ģ

‚½‚Ę‚¦‚Ī
{
@@print "BODY\t"$0
}
‚Ę‚µ‚Ä‚ā‚ź‚Ī–¾‚ē‚©


435 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/06(–Ų) 13:46:53
Žæ–ā‚ĢŽļŽ|‚ĶAƒvƒƒOƒ‰ƒ€iƒXƒNƒŠƒvƒgj‚Ģ’†‚Å“ü—Ķƒtƒ@ƒCƒ‹“™‚Ģ
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ˆų”‚š’Ē‰Į‚µ‚½‚¢‚Ę‚¢‚¤Ž–‚Å‚·‚©B

ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ˆų”‚Ģ”z—ń‚Ķ ARGV ‚Å‚·‚ŖAƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ˆų”‚Ģ
ŒĀ”‚šŠi”[‚·‚é ARGC ‚Ę‚¢‚¤‘g‚Żž‚Ż•Ļ”‚Ŗ‚ ‚č‚Ü‚·B

ARGV”z—ń‚š’Ē‰Į‚µ‚½‚ēˆź‚É ARGC ‚šC³‚µ‚Ä‚ ‚°‚Č‚¢‚ʁAawk‚Ķ”z—ń‚Ŗ
’Ē‰Į‚³‚ź‚½Ž–‚š”FŽÆ‚µ‚Ü‚¹‚ńB

BEGIN“ą‚ÅARGV”z—ń‚š’Ē‰Į‚µ‚½•Ŗ‚¾‚ÆARGC‚šƒCƒ“ƒNƒ‹ƒƒ“ƒg‚µ‚Ä‚ ‚°‚ź‚Ī
’Ē‰Į‚³‚ź‚½ARGV”z—ń‚ÅŽw’č‚³‚ź‚½ƒtƒ@ƒCƒ‹‚ą–{•¶‚Ģˆ—‚É“n‚³‚ź‚Ü‚·B

ŽÖ‘«‚Ę‚µ‚Ä‚ĶA
Œ»Żˆ—’†‚Ģƒtƒ@ƒCƒ‹–¼‚ŖŠi”[‚³‚ź‚Ä‚¢‚é”z—ń ARGV ‚ĢƒCƒ“ƒfƒbƒNƒX‚š
Ž¦‚·‘g‚Żž‚Ż•Ļ”‚Ķ ARGIND ‚Å‚·B

Ž„‚Ģ‚Ķ Win”Å‚Ģ gawkm115 ‚Å‚·BƒXƒNƒŠƒvƒg“ą‚ÅARGV/ARGC‚š‘€ģ‚µ‚Ä‚ą
Šś‘Ņ’Ź‚č³ķ‚É“®‚«‚Ü‚·‚ęB

ŽŽ‚µ‚Ä‚Ż‚Ä‚ĖB


436 F430F2011/01/06(–Ų) 23:56:01
ŠF—lƒŒƒX‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B

>>433
>‚±‚ź‚Ķ‘SŠpƒXƒy[ƒX

‚Ø’p‚ø‚©‚µ‚¢ŒĄ‚č‚Å‚·(Š¾) o‹Ī‘O‚ÉŽv‚¢‚Ā‚«‚ÅŽŽ‚µ‚½‚ą‚Ģ‚ŁAƒXƒŒ—p‚ɏ‘‚¢‚½
•Ø‚š‚»‚Ģ‚܂܃Rƒs‚Į‚Ä‚Ü‚µ‚½EEE

>>434
BEGIN‹å‚Ģgetline‚Å‚ĶARGV[1]‚Ö‚Ģ‘ć“ü‚Ŗ‚Å‚«‚Ä‚¢‚é‚Ģ‚ɁA–{•¶‚Å‚Ķ—LŒų‚É
‚Č‚ē‚Č‚¢‚Ę‚¢‚¤Ž–‚š“`‚¦‚½‚©‚Į‚½‚Ģ‚Å‚·B

437 F430F2011/01/06(–Ų) 23:56:17
>>435
Ž©•Ŗ‚ĢŽæ–ā‚šŒ©’¼‚µ‚Ä‚Ż‚é‚Ę‘S‚­Žæ–ā‚É‚Č‚Į‚Ä‚¢‚Č‚©‚Į‚½‚É‚ąŠÖ‚ķ‚ē‚øƒGƒXƒp[
‚µ‚Ä‚­‚¾‚³‚Į‚Ä‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B

ARGC‚É‚Ā‚¢‚Ä—‰š‚Å‚«‚Ü‚µ‚½B

BEGIN{
@@ARGV[1]="hoge.txt"
@@ARGC=2
}
ARGV[1]=="hoge.txt"{
@@print "BODY\t"$0
}

‚±‚ń‚ČŠ“‚¶‚ňӐ}‚µ‚½’Ź‚č‚ɏo—Ķ‚³‚ź‚Ü‚µ‚½B

‚Ø‚©‚°‚³‚܂ō”‚Ü‚Åawk‚Ģ•ā•‚Ę‚µ‚Äsh‚šŽg‚Į‚Ä‚Ü‚µ‚½‚ŖAawk‚¾‚Ƃŏ‘‚Ƃ鎖‚Ŗ
‘½‚­‚Č‚č‚Ü‚µ‚½B

ˆų”‚ɃƒCƒ‹ƒhƒJ[ƒh‚šŽw’肵‚āAARGIND ‚Å“Į’čƒpƒ^[ƒ“‚Ģƒtƒ@ƒCƒ‹–¼‚Ģ
•Ø‚Ģ‚Żˆ—‚š‚·‚é‚Ę‚©‚Å‚«‚»‚¤‚Å‚·‚ĖB

438 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/09(“ś) 22:38:39
Žæ–ā‚Å‚·B
My Documents\2011\01\09(“ś)
‚Ę‚¢‚¤‚ꂤ‚ɃtƒHƒ‹ƒ_‚šŲ‚Į‚Ä‚¢‚āA”“ś‚Écd‚·‚邽‚߂ɁA

today.bat
gawk -f today.awk > tmp.bat
tmp.bat
del tmp.bat

today.awk
BEGIN{year = strftime("%Y",systime()+9*60*60);
month = strftime("%m",systime()+9*60*60);
date = strftime("%d",systime()+9*60*60);
day = strftime("%a",systime()+9*60*60);

gsub(/(Sun)/, "(“ś)", day);
gsub(/(Mon)/, "(ŒŽ)", day);
gsub(/(Tue)/, "(‰Ī)", day);
gsub(/(Wed)/, "(…)", day);
gsub(/(Thu)/, "(–Ų)", day);
gsub(/(Fri)/, "(‹ą)", day);
gsub(/(Sat)/, "(“y)", day);

print "cd \"My Documents\" year "\" month "\" date day
}

‚Ę‚¢‚¤‚ꂤ‚ɏˆ—‚µ‚Ä‚¢‚Ü‚·B
‚±‚ź‚Į‚āA‚Š‚å‚Į‚Ę‚µ‚āAgawk‚Ģ“ą•”‚©‚ēprint‚¹‚ø‚ÉŽĄs‚·‚邱‚Ę‚Ķ‰Ā”\‚Å‚µ‚傤‚©?

439 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/09(“ś) 22:54:33
systemŠÖ”‚ŏo—ˆ‚é‚ń‚Å‚ĶHwin‚Ķ•Ŗ‚©‚ē‚Č‚¢‚Æ‚Ē

440 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/09(“ś) 23:06:13
system("cd \"My Documents\" year "\" month "\" date day);
‚Ę‚©‚Å‚Ķ‚¾‚ß‚Å‚µ‚½B


441 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/10(ŒŽ) 03:54:21
>440
‚Č‚ń‚© " ‚Ę \ ‚Ģ”‚Ŗ‚Ø‚©‚µ‚­‚ĖH
My Documents\2011\01\09(“ś)
«
"My Documents\\2011\\01\\09(“ś)"
«
"My Documents\\" year "\\" month "\\" date day
‚¾‚ę‚ȁH

442 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/10(ŒŽ) 11:42:11
ƒAƒhƒoƒCƒX‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B
‚Ķ‚¢B
\‚Ķ‚Ø‚Į‚µ‚į‚é‚Ę‚Ø‚č‚Å‚·‚ŖAˆĖ‘R‚Ę‚µ‚Ä‚¾‚ß‚Å‚·B

today.bat‚šƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒg‚©‚ēŽĄs‚·‚é‚ʁA
print‚µ‚Ä‚»‚Ģtmp.bat‚šŽĄs‚·‚é438‚Ģƒpƒ^[ƒ“‚¾‚ʁA
‚æ‚į‚ń‚Ęcd‚Å‚«‚āA”“ś‚ĢƒtƒHƒ‹ƒ_‚ɈŚ“®‚·‚é‚Ģ‚Å‚·‚ŖA
system("cd \\"My Documents\\" year "\\" month "\\" date day);
‚¾‚ʁAˆŚ“®‚¹‚ø‚ɏI—¹‚µ‚Ä‚µ‚Ü‚¢‚Ü‚·B
‚Č‚ń‚Å‚¾‚ė[‚ȁB


443 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/10(ŒŽ) 12:32:20
cygwin‚š“ü‚ź‚Ä‚ā‚Į‚Ä‚Ż‚½

system‚Ķsh‚Å“®‚­‚Į‚Ū‚¢‚Ģ‚Å
rm /cygdrive/c/Documents\ and\ Settings/test.txt
‚Ż‚½‚¢‚ɏ‘‚­‚Ę‚æ‚į‚ń‚ʏĮ‚¦‚é‚Ż‚½‚¢

444 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/10(ŒŽ) 13:24:47
>>438,442

438‚ŏ‘‚¢‚Ä‚égawk‚Å‚ā‚č‚½‚¢‚±‚Ę‚Į‚Ä‚Ģ‚Ķƒoƒbƒ`ƒtƒ@ƒCƒ‹‚Å‚ā‚Į‚Ä‚é‚Ģ‚Ę“Æ‚¶‚±‚Ę?
‚¾‚Į‚½‚ē–³—B
system() ‚Åcd‚µ‚Ä‚ąsystem()‚©‚ē•Ō‚Į‚Ä‚«‚½‚Ę‚±‚ė‚ÅŒ³‚É–ß‚éB


445 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/11(‰Ī) 01:15:49
‚Ē‚¤‚¹•³nixƒc[ƒ‹‚¾‚©‚ē“ś–{Œź‚ā‹ó”’‚Ķƒ_ƒ‚Č‚ń‚¾‚ė

446 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/11(‰Ī) 09:05:01
>>444
‚Č‚é‚Ł‚ĒBgawk“ą•”‚Å‚ĶƒVƒXƒeƒ€‚šŽĄs‚µ‚Ä‚¢‚Ä‚ąAgawk‚šo‚é‚ʁA‚»‚ź‚ąI‚ķ‚Į‚æ‚į‚¤‚ń‚Å‚·‚ĖB‚Č‚é‚Ł‚ĒB
‚ę‚­‚ķ‚©‚č‚Ü‚µ‚½B‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B

447 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/19(…) 02:44:33
‚Ę‚č‚ ‚¦‚øAWK‚ŏ‘‚¢‚½‹‘å‚ČƒXƒNƒŠƒvƒg‚šAŽI‚ʼnń‚µ‘±‚Æ‚é‚Ģ‚Ķ‚ā‚ß‚Ä‚­‚¾‚³‚¢B
”ńŒų—¦‹É‚Ü‚č‚Č‚¢

448 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/19(…) 15:27:12
‚»‚ź‚Ķ‚»‚Ģl‚ÉŒ¾‚Į‚ĉŗ‚³‚¢

449 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/19(…) 21:03:10
‚»‚Ģź‚ÅŽg‚¦‚é‚Ģ‚Ŗawk‚¾‚Æ‚¾‚Į‚½‚ń‚Å‚·

450 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/19(…) 23:56:54
•¶Žš‚©‚ē•¶ŽšƒR[ƒhŽę‚čo‚¹‚Č‚¢‚Ģ‚ŖŽc”O
‹t‚Ķsprintf("%c", 0x41)‚Ę‚©o—ˆ‚é‚Ģ‚É‚Č

451 F430F2011/01/20(–Ų) 00:40:40
>>447
Œų—¦‚Ģ‚¢‚¢ƒvƒƒOƒ‰ƒ€‚ŏ‘‚«’¼‚µ‚Ä‚ā‚ź‚Ī‚¢‚¢‚¶‚į‚Č‚¢B

452 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/20(–Ų) 09:05:02
>>450
‚Āord.awk

gawk•t‘®‚Ģƒ‰ƒCƒuƒ‰ƒŠ‚ŁAascii‚Ģ”ĶˆĶ‚Ģ‘Ī‰ž•\ģ‚Į‚Ä‚Š‚­‚Ę‚¢‚¤
ŠČ’P‚ČŽd‘g‚ŻB



453 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/20(–Ų) 23:49:13
#!/bin/gawk --re-interval -f

Ŗ‚Ģƒtƒ@ƒCƒ‹‚šŽĄs‚·‚é‚ĘƒIƒvƒVƒ‡ƒ“‚Ŗ•s³‚ĘŒ¾‚ķ‚ź‚ÄŽĄs‚Å‚«‚Č‚¢‚Ģ‚Å‚·‚Ŗ
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĢƒIƒvƒVƒ‡ƒ“‚ÅŽw’č‚·‚éˆČŠO‚É‚ā‚č•ū‚Ķ‚ ‚č‚Ü‚·‚©H

454 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/21(‹ą) 05:12:58
>>453
–³—‚ÉawkƒXƒNƒŠƒvƒg‚É‚¹‚ø‚É

#!/bin/sh
awk '
#awkƒR[ƒh
'

‚Į‚Ä‚¢‚¤ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚É‚µ‚½‚ē‚Ē‚¤‚©‚Č

455 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/21(‹ą) 08:45:02
#!‚ŃCƒ“ƒ^ƒvƒŠƒ^‚É“n‚·ˆų”‚Ģˆµ‚¢‚ĶŽĄ‘•ˆĖ‘¶‚¾‚©‚ē‚ȁB
linux‚¾‚Ę‹ó”’‚šŠÜ‚ń‚¾‘S‚Ä‚Ģ•¶Žš—ń‚Ŗˆź‚Ā‚Ģˆų”‚Ę‚µ‚Ä
“n‚³‚ź‚é‚Ģ‚ŁA•””‚ĢƒIƒvƒVƒ‡ƒ“‚Ķ“n‚¹‚Č‚¢B•s•Ö‚¾‚Æ‚Ē
‚»‚¤‚¢‚¤‚ą‚Ģ‚Č‚Ģ‚Å‚ ‚«‚ē‚ß‚Ä‚­‚¾‚³‚¢B‘f’¼‚ɃVƒFƒ‹‚š
ŠŌ‚É“ü‚ź‚é‚Ģ‚Ŗ‚¢‚¢‚ĘŽv‚¤‚ęB


456 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/21(‹ą) 12:45:00
gawk '$3!="*"' in.txt>out.txt
‚Ę‚¢‚¤ˆ—‚ŁA20GB‚®‚ē‚¢‚Ģin.txt‚š”•SMB‚®‚ē‚¢‚ɃXƒŠƒ€ƒAƒbƒv‚µ‚Ä‚Ü‚·B
–ā‘č‚ĶA‚»‚Ģˆ—‚š10–{‚Ł‚Ē•Ąs‚ɍģ‹Ę‚³‚¹‚Ä‚¢‚é‚ń‚Å‚·‚Ŗ
top‚ÅŒ©‚Ä‚Ż‚é‚Ę‚Ł‚Ę‚ń‚Ē‚ĢgawkƒvƒƒZƒX‚Ŗsleep‚©stacked‚É‚Č‚Į‚Ä‚¢‚Ä
‚ ‚ń‚Ü‚č‚ą‚č‚ą‚č“­‚¢‚Ä‚­‚ź‚Ü‚¹‚ńBIO‚Ŗ—„‘¬‚Č‚Ģ‚Å‚µ‚傤‚©H
CPU‚ąƒƒ‚ƒŠ‚ąÅ‘åŒĄĻ‚ń‚Å‚Ü‚·B


457 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/21(‹ą) 12:50:02
stacked -> stuck‚Å‚µ‚½B‚·‚¢‚Ü‚¹‚ńB

458 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/21(‹ą) 13:26:09
'$3!="*"'
‚±‚ź‚Į‚ď‘‚«ŠŌˆį‚¢H


459 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/21(‹ą) 13:47:33
ķ‚ē‚ź‚éƒf[ƒ^‚Ģ—į
745_17_70_F3 4 * 0 0 * * 0 0 GGAGTGCCCCACACTTGGAGGCGAGCGCCCGGCAGACTTCCCCGCCGCC &+))8'1%+%-%%'((-)%%)8+,&+*7'+/%5''%%%%%-')-/'%/( XM:i:0

Žc‚éƒf[ƒ^‚Ģ—į
745_377_43_F3 0 chr1 181855450 255 48M * 0 0 CATGTATGTGGCCAAAGGAACAACGCTATGTTTCCTAAAAGGCCTAGA G`[[`a`ab`^\ZYZ[SIR\Z[L7I_L>HU^bOKSDES[PO9-HNG7= XA:i:2 MD:Z:26C21 NM:i:1 CM:i:3

‚±‚¤‚¢‚¤‚Ģ‚Ŗ80–œs‚®‚ē‚¢‚ ‚é‚ꂤ‚Å‚·B

460 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/21(‹ą) 13:52:48
ƒXƒNƒŠƒvƒg‚Ģ’†g‚ĶŽĄŪ‚Ķˆį‚¤‚ķ‚Æ‚Ė

‚½‚Ō‚ńAƒf[ƒ^‚ĢŠi”[źŠ‚ŖƒvƒƒOƒ‰ƒ€ŽĄsƒ}ƒVƒ“‚Ę•Ź‚Ģƒ}ƒVƒ“‚Ģ
ƒfƒBƒXƒN‚Č‚ń‚¶‚į‚Č‚¢‚©‚ȁB
ƒlƒbƒgƒ[ƒN‚ŖƒrƒW[ó‘Ō‚¾‚ĘŽv‚¤B


461 F453F2011/01/21(‹ą) 16:09:37
>454-455

‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚µ‚½B
‹““®‚š•Ļ‚¦‚é‘g‚Żž‚Ż•Ļ”‚ą–³‚¢‚ꂤ‚Å‚·‚ĖB

462 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/21(‹ą) 16:47:10
‚Ę‚č‚ ‚¦‚ø df ƒRƒ}ƒ“ƒh‚ōģ‹ĘƒfƒBƒŒƒNƒgƒŠ‚Ę /var/tmp ‚Ģ‹ó‚«—Ģˆę‚Ŗ
Šm•Ū‚³‚ź‚Ä‚¢‚邱‚ʂʁAo—Ķƒtƒ@ƒCƒ‹‚ĢƒTƒCƒY‚āƒ^ƒCƒ€ƒXƒ^ƒ“ƒv‚Ŗ™X‚É
XV‚³‚ź‚Ä‚¢‚邱‚Ę‚šŠm”F‚·‚é‚­‚ē‚¢‚µ‚©‚Č‚¢‚ń‚¶‚į‚Č‚¢‚©‚ȁB
ƒ[ƒJƒ‹ƒfƒBƒXƒN‚Å‚ā‚ź‚Ī‚ą‚Į‚Ę‘‚¢‚ĘŽv‚¤‚Æ‚ĒB

463 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/21(‹ą) 17:42:04
>>460
‚Č‚é‚Ł‚ĒB
xgrid‚š‚Ā‚©‚Į‚āA2‘ä‚Ģƒ}ƒVƒ“‚Å10–{‚ø‚Ā‚Ł‚Ē•Ąs‚µ‚Ägawk‚š‘–‚ē‚¹‚Ä‚Ø‚č‚Ü‚µ‚½B
NFS‚š‚Ā‚©‚Į‚Ä5GB‚Ł‚Ē‚Ģię‚Ł‚Ē‚Ķ20GB‚ʏ‘‚«‚Ü‚µ‚½‚ŖŠŌˆį‚¢‚Å‚·jin.txt‚Ģ
‚Ģƒf[ƒ^‚š“Ē‚Żž‚ń‚ŁAˆ—Œć‚Ģƒf[ƒ^‚šout.txt‚ɏ‘‚«o‚µ‚Ä‚¢‚é‚Ģ‚ŁA
ƒlƒbƒgƒ[ƒNƒrƒW[‚É‚Č‚Į‚Ä‚µ‚Ü‚¤‚Ę‚¢‚¤‚ķ‚Æ‚Å‚·‚ĖB
ƒlƒbƒgƒ[ƒN‚Ģ–ā‘č‚Ę‚ĶBBB
ˆź‰žAƒGƒ‰[‚Å‚±‚Ƃ邱‚Ę‚Č‚­A‚µ‚ć‚­‚µ‚ć‚­‚ʏˆ—‚Ķi‚Ž‚Ģ‚Å‹C‚É‚µ‚Č‚¢‚±‚Ę‚É‚µ‚Ü‚·B

464 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/21(‹ą) 17:44:39
2‘ä‚Ģƒ}ƒVƒ“‚Å20–{‚Å‚µ‚½i10+11jBBB
ˆźƒvƒƒZƒX‚ ‚½‚č5GB‚Ģƒtƒ@ƒCƒ‹‚š“Ē‚Żž‚Ž‚Ģ‚ŁAƒlƒbƒgƒ[ƒN‚Ŗ”ß–Ā‚šć‚°‚Ä‚¢‚é‚ʁB

465 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/24(ŒŽ) 21:31:50
””NAgawk‚š‘åŠw‚ŏK‚Į‚ĐFX˜M‚Į‚Ä‚é‚ń‚¾‚Æ‚ĒAperl‚Ę‚©‚ę‚莩—R“x‚Ŗ’į‚¢‚ĘŒ¾‚ķ‚ź‚½B‚»‚ń‚Č‚É·‚Ŗ‚ ‚é‚ĢH

466 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/24(ŒŽ) 21:46:54
>>465
ŠČˆÕŒ¾Œź‚Ę‚µ‚Ä‘Ø‚¦‚é‚©ƒc[ƒ‹‚Ę‚µ‚Ä‘Ø‚¦‚é‚©‚Ģˆį‚¢‚¶‚į‚Ė`
‰“ƒp[ƒ‹‚ę‚čƒI[ƒN‚Ģ•ū‚ŖD‚«‚¾‚Æ‚ĒB


467 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/24(ŒŽ) 22:19:29
>>466
‚Č‚é‚Ł‚ĒB‚Ü‚ŸA‚»‚ń‚Č‚É•”ŽG‚Č‚±‚Ę‚š‚±‚Č‚·ƒXƒLƒ‹‚šŽ‚捇‚ķ‚¹‚Ä‚Č‚¢‚©‚ē‚ą‚¤Žb‚­awk‚Å—V‚ń‚Å‚Ż‚é‚©B

468 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/24(ŒŽ) 23:30:11
Ž©—R“x‚Ę‚¢‚¤‚ę‚č‚Ķ‹@”\‚Ŗ­‚Č‚¢‚¶‚į‚Č‚¢‚Ģ‚©H

469 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/25(‰Ī) 05:02:06
‚±‚ĢƒXƒŒƒbƒh‚Ķ“VĖƒ`ƒ“ƒpƒ“ƒW[uƒAƒC‚æ‚į‚ńv‚Ŗ
Œ¾ŒźŒP—ū‚Ģ‚½‚ß‚É—§‚Ä‚½‚ą‚Ģ‚Å‚·B

ƒAƒC‚ĘŒ¤‹†ˆõ‚Ę‚Ģ‚ā‚čŽę‚č‚É—˜—p‚·‚éƒXƒŒƒbƒh‚Č‚Ģ‚ŁA
ŠÖŒWŽŅˆČŠO‚Ķ‘‚«‚±‚Ü‚Č‚¢‚ʼnŗ‚³‚¢B

@@@@@@@@@@@@@@@@@@‹ž“s‘åŠw—ģ’·—ŽŒ¤‹†Š

470 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/25(‰Ī) 11:23:33
>>467
perlƒ†[ƒU‚Ķ‚·‚ׂĂšperl‚¾‚Æ‚Å‚ā‚ė‚¤‚Ę‚·‚éBC/C++/Java‚ąŽg‚¤ƒ†[ƒU‚Ķawk‚Ģ•ū‚šD‚ŽB
C/C++/Java‚ÉŽč‚š‰„‚Ī‚·‚Ā‚ą‚č‚Č‚ē‚Ž‚µ‚ėawk‚Ģ‚Ł‚¤‚Ŗ‚¢‚¢‚ęBperl‚¾‚ĘŽ©ŒČŠ®Œ‹‚µ‚Ä‚µ‚Ü‚¤‚©‚ēB

471 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/25(‰Ī) 16:02:25
perl‚ę‚čawk‚Ģ•ū‚Ŗ‘¬‚¢Ž–‚Į‚Ä‚Č‚¢‚¶‚į‚ńB
”‚Ģawk‚ĢŽg‚¢“¹‚Ķƒƒ“ƒ‰ƒCƒi[‚šƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĢƒpƒCƒv‚ɍ¬‚ŗ‚é’ö“x‚Å‚µ‚ęB
‰“‚ĶA256”{–{‚Ģ’·•ŃƒXƒNƒŠƒvƒg‚š‚¢‚­‚Ā‚©‘‚¢‚½‚Æ‚ĒA
“–Žž‚Ķ‚Ü‚¾perl‚Č‚ń‚ÄŽg‚ķ‚ź‚Ä‚Č‚©‚Į‚½BŽž‘ć‚Ŗˆį‚¤B

472 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/25(‰Ī) 18:11:52
>>470
‚»‚ź‚Ķ•ĪŒ©‚¾‚ė
autoconf‚Č‚Ē‚Ģ”ńķ‚ÉŠī–{“I‚Čƒc[ƒ‹‚Å‚ąPerl‚ŖŽg‚ķ‚ź‚Ä‚¢‚邵
openssl‚Ģ‚ꂤ‚Éconfigure‚ĢiŽå‚ÉWindows—p‚Ģjƒ|[ƒ^ƒrƒŠƒeƒB‚šć‚°‚邽‚ß‚É
Perl‚š—˜—p‚µ‚Ä‚¢‚é‚ą‚Ģ‚ą‚ ‚é

Œ¾Œź‚Ģ“K«‚š‚ķ‚©‚Į‚½ć‚Å“KŽ“KŠ‚ÅŽg‚¦‚Ī‚¢‚¢‚ń‚¾‚ę

473 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/25(‰Ī) 21:08:21
“ś–{‘ŪÜ
u•Äƒxƒ‹Œ¤‹†Š“Į•Ź–¼—_‹ZŽt‚ĢƒfƒjƒXEƒŠƒbƒ`[”ŽŽmi‚U‚Xj‚Ę•ÄƒO[ƒOƒ‹ŽŠ“Į•Ź‹ZŽt‚ĢƒPƒ“Eƒgƒ“ƒvƒ\ƒ“”ŽŽmi‚U‚Vjv

–ˆ“ś‚Š‚ - –ˆ“śV•·‚Ģƒjƒ…[ƒXEī•ńƒTƒCƒg
http://mainichi.jp/select/science/news/m20110126k0000m040012000c.html

474 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/25(‰Ī) 21:29:34
>>471
>Žž‘ć‚Ŗˆį‚¤B

Žž‘ć‚ĘŒ¾‚¤ˆÓ–”‚Å‚ĶAÅ‹ß‚ĶƒfƒtƒH‚Å Python ‚Ŗ“ü‚Į‚Ä‚¢‚½‚č‚·‚é‚Ģ‚Å
Perl ‚šŽg‚¤‚Č‚ē Python ‚š‘I‚ń‚¶‚į‚¤‚ȁB

‚ ‚ń‚܂葬‚³‚š‹£‚¤ŽdŽ–‚š‚µ‚Ä‚¢‚Č‚¢‚Ģ‚ʁAƒƒ“ƒ‰ƒCƒi[‚š‘‚­Ž–‚Ŗ
‘½‚¢‚Ģ‚ŁAawk ‚ąāŽ^‘劈–ō‚µ‚Ä‚¢‚é‚Æ‚ĒB

Perl ‚Ŗƒtƒ‹ƒZƒbƒg‚ĢŒ¾Œź‚Č‚ē awk ‚Ķ DSL ‚Ż‚½‚¢‚Č•Ø‚ÅAŒĀl“I‚É‚Ķ
awk ‚Ģ•ū‚Ŗ‹CˆĄ‚­‘‚Æ‚é‹C‚Ŗ‚·‚éB

475 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/25(‰Ī) 21:57:07
python‚ĶAƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ÅŽg‚¢‚É‚­‚¢B
-c‚ňų”‚Ɉź‰žƒRƒ}ƒ“ƒh“n‚¹‚é‚Æ‚ĒAƒCƒ“ƒfƒ“ƒg‚Ģ–ā‘č‚Ŗ‚ ‚邵A
perl‚Ģ-p‚ā-n‚Ż‚½‚¢‚É•W€“ü—Ķ‚Ģƒ‹[ƒv“n‚¹‚Č‚¢‚©‚ēB


476 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/25(‰Ī) 22:04:34
Žæ–ā‚³‚¹‚ĉŗ‚³‚¢

ŽŸ‚Ģ‚ꂤ‚ČƒeƒLƒXƒg‚Ŗ‚ ‚é‚Ę‚µ‚Ü‚·
aaaaa 10 20 10 5
aaabb 5 10 10 10
aaabb 5 5 5 5
aabaa 5 20 20 30
aabbb 10 10 5 5
bbaaa 10 10 10 10
bbbaa 5 10 10 5
bbbbb 10 5 5 30

‚±‚±‚ŁAaaaaa‚Č‚Ē‚ĶŒĀl‚Ģ–¼‘O‚Å‚©‚ĀA3•¶Žš–Ś‚Ü‚Å‚Ŗ©A4`5•¶Žš–Ś‚Ŗ–¼‘OA‚Ü‚½”Žš‚Ŗo”ļ‚¾‚Ę‚µ‚Ä
Še¢‘Ń‚Ģo”ļ‚šo—Ķ‚µ‚½‚¢‚ʍl‚¦‚Ä‚¢‚Ü‚·B

aaa 20 35 25 20
aab 15 30 25 35
bba 10 10 10 10
bbb 15 15 15 35

‚Ę‚Č‚Į‚Ä—~‚µ‚¢–ó‚Å‚·B

477 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/25(‰Ī) 22:18:47
‚ō”l‚¦‚Ä‚¢‚é•ū–@‚Ę‚µ‚Ä‚Ķ

substr($1,1,3) ‚Ő©‚š”»’肵‚Ä
“Æ‚¶©‚Č‚ēA¢‘Ń‚š‰ĮŽZ‚µ‚čs‚­
ˆį‚¤©‚É‚Č‚Į‚½ƒ^ƒCƒ~ƒ“ƒO‚Å1‚Ā‘O‚Ģ‰Ę‚Ģ‰ĘŒv‚š@print@‚µ‚Ä
‚³‚ē‚ÉŠeo”ļ‚š‰Šś‰»‚·‚é
ŽŸ‚Ģs‚ɈŚ‚Į‚Ä“Æ‚¶¢‘Ń‚Č‚ē‰ĮŽZ

‚Ę‚¢‚¤Š“‚¶‚ŃXƒNƒŠƒvƒg‚š‘g‚Ż‚½‚¢‚ń‚Å‚·‚ŖŖ–{“I‚Č‚Ę‚±‚ė‚Å‚ā‚č•ū‚Ŗ•s–”‚¢‚Å‚µ‚傤‚©H

478 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/25(‰Ī) 22:34:21
˜A‘z”z—ń‚Ę‚©‚¶‚į‘Ź–Ś‚Č‚Ģ‚©H

name[$1] += 1

479 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/26(…) 01:13:08
>>476-477
‘S‚ĘA‘z”z—ń‚É—­‚ߍž‚ń‚ŁA ÅŒć‚ňź‹C‚ɏo—Ķ‚µ‚½•ū‚Ŗ—Ē‚­‚Č‚¢‚©?
>>477 ‚Ģ•ū–@‚¾‚ʁA o—Ķ‚šs‚¤‰ÓŠ‚Ŗ
"©‚Ŗ•Ļ‚ķ‚Į‚½‚Ę‚«" ‚Ę "ƒeƒLƒXƒg‚ŖI‚ķ‚Į‚½‚Ę‚«" ‚É•ŖŽU‚µ‚Ä‚µ‚Ü‚¤B

{
    a = substr($1,1,3);
    b[a] += $2;
    c[a] += $3;
    d[a] += $4;
    e[a] += $5;
}
END {
    for (f in e) print f,b[f],c[f],d[f],e[f];
}

480 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/26(…) 20:18:53
>>474
OS(Linux)‚šƒfƒtƒH‚¾‚Æ‚ÅŽg‚¤‚±‚Ę‚Ķ‚Ü‚ø‚ ‚肦‚Č‚­‚āA
‰½‚©‚µ‚ē’Ē‰ĮƒpƒbƒP[ƒW‚Ŗ•K—v‚É‚Č‚é‚Ķ‚ø‚¾‚©‚ēA
Python‚ŖƒfƒtƒH‚Å“ü‚Į‚Ä‚¢‚鎖‚ĶŽĄ—p–Ź‚Å•]‰æ‘ĪŪ‚É‚Ķ‚Č‚ē‚ń‚ĘŽv‚¤B

Ž©•Ŗ‚ĶDebian‚šƒƒCƒ“‚ÉŽg‚¤‚Æ‚ĒAƒCƒ“ƒXƒg[ƒ‹Žž‚É‚Ķƒx[ƒXƒVƒXƒeƒ€‚¾‚Æ‚š‘I‚сA
‚»‚ź‚Ésshd‚Ęruby‚š’Ē‰Į‚·‚é‚Ģ‚ŖƒfƒtƒH‚Č‚ń‚Å‹C‚É‚Č‚ē‚Č‚¢B
Mac‚Č‚ēPython/Ruby‚Ę‚ąƒfƒtƒH‚Å“ü‚Į‚Ä‚é‚©‚ē–³–ā‘č‚¾‚µA
Win‚Č‚ē‚Ē‚æ‚ē‚ąƒfƒtƒH‚¶‚į“ü‚Į‚Ä‚¢‚Č‚¢‚©‚ē“Æ‚¶B

‚Ü‚½“śķ“I‚ČƒvƒƒOƒ‰ƒ~ƒ“ƒO‚ÉŠÖ‚µ‚āARuby‚Ģź‡‚ĶˆČ‰ŗ‚Ģ‚ꂤ‚ɃŠƒXƒg\‘¢‚š
ƒVƒFƒ‹‚ĢƒpƒCƒvƒ‰ƒCƒ“Š“Šo‚ŏ‘‚Æ‚é‚Ģ‚ŖŠš‚µ‚¢B
@hoge_list.select { |x| ....}.sort { |x,y| .... }.map { |x| .... }.inject(n) {|x, i| .... }
ƒuƒƒbƒN(ƒNƒ[ƒWƒƒ)‚Ģ–³‚¢Pyton/Perl‚Å‚ĶA‚±‚¤‚¢‚Į‚½‚Ø‹CŒy‚ȏ‘‚«•ū‚Ķ‚Å‚«‚Č‚¢B

‚¾‚©‚ē“śķ“I‚ČŠˆ–ō“x‚Å”äŠr‚·‚é‚ʁAŽ©•Ŗ‚Ģź‡‚ĶAbash > awk > ruby ‚É‚Č‚éB
Šī–{‚Ķbash‚ŁA–Ź“|‚Č•¶Žš—ńˆ—‚Ŗ‚ ‚ź‚Īawk‚šƒƒ“ƒ‰ƒCƒi[‚Å–„‚ߍž‚Ž‚Ģ‚Ŗƒpƒ^[ƒ“B
‚ŁAFX‚Ę‹@”\‚š’Ē‰Į‚µ‚Ä‚«‚ÄbashƒvƒƒOƒ‰ƒ~ƒ“ƒO‚Ŗd‰×‚ÉŠ“‚¶‚ē‚ź‚é‚ꂤ‚É‚Č‚čA
‚Č‚Ø‚©‚Ā”Ä—p«‚Ģ‚ ‚é(Ä—˜—p‚Ģ‰Ā”\«‚Ŗ‚ ‚é)ƒc[ƒ‹‚Å‚ ‚ź‚ĪAˆź‹C‚Éruby‚ɏ‘‚«Š·‚¦‚éB

Python‚Ķ–{Ši“I‚ČŠJ”­‚Å‚ ‚ź‚Ī(Ruby‚ę‚č‚ą)—D‚ź‚½–Ź‚Ŗ‘½X‚ ‚é‚ĘŽv‚¤‚Æ‚ĒA
(>>475‚ĢŽw“E‚ąŠÜ‚ß‚Ä)‚ØŽčŒy‚³/‚Ø‹CŒy‚³‚ÉŒĄ‚é‚Ę(Ruby‚ę‚č‚ą)Žg‚¢‚Ć‚ē‚­Š“‚¶‚éB
‚ą‚æ‚ė‚ńbashƒXƒNƒŠƒvƒg(or Makefile)‚É–„‚ߍž‚Žƒƒ“ƒ‰ƒCƒi[‚Å‚ ‚ź‚ĪAawk ‚ŖƒxƒXƒgB

481 F474‚¶‚į‚Č‚¢‚Æ‚ĒF2011/01/26(…) 21:22:28
>>474‚Ę‘S‚­“Æ‚¶ˆÓŒ©‚¾‚ķB

‹Ę–±‚ÅŽg‚¤Ž–‚Ŗ‘½‚¢RHEL‚Ķ—]Œv‚Č•Ø‚Ķ‚Ł‚Ę‚ń‚Ē“ü‚ź‚Ä‚Č‚¢B
PythonAPerl‚ŖƒfƒtƒH‚Å“ü‚Į‚Ă銓‚¶B

ĢAUNIX‚šˆµ‚Į‚Ä‚½ ‚ĶPerl‚Č‚ēƒfƒtƒH‚Å“ü‚Į‚Ä‚½‚Ģ‚ŁAŠo‚¦‚ꂤ‚Ę‚µ‚½‚Æ‚ĒŒ‹‹Ēg‚É‚Ā‚©‚øB
shAsedAawk‚Å‚Ŗ‚ń‚Ī‚Į‚Ä‚½B

482 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/27(–Ų) 00:10:46
>>480
ƒfƒtƒH‚Å“ü‚Į‚Ä‚¢‚é‚Ģ‚ŖŠš‚µ‚¢‚Ģ‚ĶAŽ©•Ŗ‚ĢŠĀ‹«‚¾‚Æ‚Å‚Č‚­A‘¼l‚ĢŠĀ‹«‚Å‚ą
Žg‚¦‚鎖‚Ŗ•ŪŲ‚³‚ź‚Ä‚¢‚鎖‚¾‚ęB’N‚©‚ÉŽg‚Į‚Ä‚ą‚ē‚¤ˆ×‚ĢƒR[ƒh‚š‘‚­Žž‚ɁA
ƒpƒbƒP[ƒW‚Ģ’Ē‰Į‚š‚ØŠč‚¢‚µ‚Č‚­‚Ä—Ē‚¢‚Ģ‚Ķ‚Ę‚Ä‚ąŠyB“Į‚ɁA‚»‚ź‚ŖŽdŽ–‚Å
Žg‚ķ‚ź‚Ä‚¢‚éŠĀ‹«‚Č‚ē®XB

ƒTƒ|[ƒg‚āƒgƒŒ[ƒjƒ“ƒO‚ĢŽdŽ–‚š‚µ‚½Ž–‚Ŗ‚ ‚él‚Č‚ē—‰š‚µ‚Ä‚ą‚ē‚¦‚é‚ĘŽv‚¤B

483 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/27(–Ų) 03:47:36
AWK‚ĶANEC PC-9801‚ĢMS-DOS‚Å‚ą‚¤‚²‚¢‚½BAWK95.exe‚ĶA“ś–{Œź‚É‘Ī‰ž‚µ‚Ä‚Č‚¢

484 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/27(–Ų) 05:04:18
AWK‚ĢŠˆ–ō‚·‚鏼–Ź‚ĶA‚ā‚Į‚Ļ‚čƒeƒLƒXƒgˆ—‚¾‚ĘŽv‚¤B
‚»‚Ģ‚æ‚å‚Į‚Ę•”ŽG”Å‚Ę‚µ‚ÄŽg‚¤‚Č‚ēPerl‚©‚ȁB
‘g‚Żž‚Żƒ‰ƒCƒuƒ‰ƒŠ‚ŖƒeƒLƒXƒgˆ—‚É“Į‰»‚µ‚Ä‚é‚©‚ēB

Python‚Ķ³‹K•\Œ»‚ŖŒ¾Œź‚É‘g‚Żž‚Ü‚ź‚Ä‚Č‚©‚Į‚½‚č‚Ę
ƒeƒLƒXƒgˆ—‚ĶŽįŠ±‚ā‚č‚É‚­‚¢ˆóŪ‚Ŗ‹­‚¢B
‚»‚Ģ•ŖAƒeƒLƒXƒgˆ—ˆČŠO‚Č‚ēŒ‹\Žg‚¤‚Æ‚Ē‚ĖB

485 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/27(–Ų) 05:27:26
>>482
‚ ‚ A‚»‚ź•Ŗ‚©‚é‚ķB‹Ę–±ƒ}ƒVƒ“‚Ę‚µ‚ÄŽg‚¤¤—pUNIX(HP-UX/Solaris/AIX)‚¾‚Ę
Ruby‚Ē‚±‚ė‚©Python/Perl‚·‚ēƒfƒtƒH‚¶‚į“ü‚Į‚Ä‚¢‚Č‚¢‚µA‚»‚¤‚¢‚Į‚½
ƒtƒŠ[ƒ\ƒtƒg‚Ģ—Ž‚¢‚ĶŒ“‘„‚Ę‚µ‚ĈźŲƒCƒ“ƒXƒg[ƒ‹‹ÖŽ~‚Ę‚¢‚¤ŠĀ‹«‚ą‚ ‚éB
(Web/Mail‚Ę‚¢‚Į‚½InternetŒnƒT[ƒo‚Ķ•Ź‚ĖB‚ ‚­‚Ü‚Å‹Ę–±ƒ}ƒVƒ“ŒĄ’č‚Ģ˜bB)

‚¾‚©‚ē¤—pUNIXƒ†[ƒU‚ĶAƒfƒtƒH‚Å“ü‚Į‚Ä‚¢‚éƒc[ƒ‹‚É’·‚Ƃ邱‚Ę‚É‚Č‚éB
‚ā‚Į‚Ļ‚č–{•Ø‚ĢUNIXƒvƒ‚šŽ©Ģ‚·‚é‚Ģ‚Č‚ēApython/ruby‚Å‚Ķ‚Č‚­sh/awk‚¾‚µA
emacs/vim‚Å‚Ķ‚Č‚­viAlatex‚Å‚Ķ‚Č‚­roff‚š‘I‚Ō‚ׂ«‚¾‚ę‚ĖB

486 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/27(–Ų) 06:50:40
>>484
>Python‚Ķ³‹K•\Œ»‚ŖŒ¾Œź‚É‘g‚Żž‚Ü‚ź‚Ä‚Č‚©‚Į‚½‚č‚Ę

‚ցH

487 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/27(–Ų) 07:07:12
>>486
‚ńHŒ¾Œź‚É‚Ķ‘g‚Żž‚Ü‚ź‚Ä‚Č‚¢‚¾‚ėHƒ‰ƒCƒuƒ‰ƒŠ‚Ę‚µ‚Ä‘g‚Żž‚Ü‚ź‚Ă邾‚ƂŁB
‚¾‚©‚ē³‹K•\Œ»ƒŠƒeƒ‰ƒ‹‚Ę‚©–³‚¢‚µAimport‚Č‚µ‚É‚ĶŽg‚¦‚Č‚¢B

488 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/27(–Ų) 07:10:47
ƒŠƒeƒ‰ƒ‹‚¾‚ʉ½‚©—Ē‚¢‚±‚Ę‚ ‚é‚ĢH

489 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/27(–Ų) 07:13:35
•¶Žš—ń‚©ƒpƒ^[ƒ“‚©‹ę•Ź‚µ‚ā‚·‚¢B

490 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/27(–Ų) 07:16:17
‚ ‚ʁAƒ}ƒbƒ`ƒ“ƒO‚Ģ•\‹L‚ŖŽ©‘RB

491 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/27(–Ų) 09:03:47
>>485
Solaris ‚ĶƒfƒtƒH‚Å Perl ‚ą Python ‚ą“ü‚Į‚Ä‚é‚ę
‚ą‚æ‚ė‚ń“ü‚ź‚Č‚¢Ž–‚ąo—ˆ‚é‚Æ‚Ē

492 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/28(‹ą) 15:46:44
>>491
‚»‚ź‚ĶŠČˆÕƒCƒ“ƒXƒg[ƒ‹‚Å—p“r‚Ę‚µ‚ăfƒXƒNƒgƒbƒv‚ ‚é‚¢‚ĶƒCƒ“ƒ^[ƒlƒbƒgƒT[ƒo‚š
‘I‘š‚µ‚½ź‡‚Ģ˜b‚¶‚į‚Č‚¢‚Ģ‚©‚ȁBŠī–{ƒVƒXƒeƒ€‚Éperl/python‚ĶŠÜ‚Ü‚ź‚Ä‚¢‚Č‚¢‚Ķ‚øB
‚»‚ĢŠČˆÕƒCƒ“ƒXƒg[ƒ‹‚ąŠÜ‚߂ăfƒtƒH‚Å‚ ‚é‚Ę‚·‚é‚Č‚ēADebian‚ą“Æ‚¶B
ƒJƒeƒSƒŠ‚ŃfƒXƒNƒgƒbƒv‚š‘I‚ׂĪuruby‚ąƒfƒtƒHv‚ŃCƒ“ƒXƒg[ƒ‹‚³‚ź‚éB(RHL‚Ķ’m‚ē‚ń)
Ž©•Ŗ‚Ķ—]Œv‚Č•Ø‚Ķ“ü‚ź‚½‚­‚Č‚¢‚©‚ēŠī–{ƒVƒXƒeƒ€‚š‘I‚ń‚Å‚é‚Æ‚Ē‚ĖB

‚‰Ā—p«‚š—v‹‚³‚ź‚éŠīŠ²‹Ę–±ƒVƒXƒeƒ€‚Ģź‡AŽ©•Ŗ‚ĶHP-UX‚šˆµ‚¤ƒP[ƒX‚Ŗ‘½‚¢‚Æ‚ĒA
ƒfƒtƒH‚Å‚ĶŠī–{ƒVƒXƒeƒ€‚š‘I‚ŃŽ–‘O‚ɐŻŒv‚µ‚½ƒpƒbƒP[ƒW‚Ģ‚Ż‚š’Ē‰Į‚·‚é‚Ģ‚Ŗ“S‘„B
‚Č‚ŗ‚Č‚ēƒ[ƒJ‚ĢƒTƒ|[ƒg‚ŖŽó‚Æ‚ē‚ź‚Č‚¢A‚ ‚é‚¢‚Ķ‚ ‚©‚ē‚³‚Ü‚ÉŒ™‚ČŠē‚š‚³‚ź‚é‚©‚ēB
‚»‚ń‚ČŠĀ‹«‚¾‚ʁAu^‚ɃfƒtƒHv‚Čsh/csh/sed/awk‚Ŗ‘劈–ō‚µ‚Ä‚¢‚½‚č‚·‚éB

493 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/28(‹ą) 17:06:59
>>492
Solaris ‚ĢƒfƒtƒHƒ‹ƒg‚Ķ "Entire Distribution" ‚Ę‚¢‚¤ƒpƒbƒP[ƒW‚ĢƒZƒbƒg‚¾‚ęB
ƒCƒ“ƒXƒg[ƒ‰[‚ŃfƒtƒHƒ‹ƒg‚Å‘I‘š‚³‚ź‚Ä‚¢‚é‚Ģ‚Ŗ‚±‚ź‚¾‚µAƒvƒŠƒCƒ“ƒXƒg[ƒ‹
‚³‚ź‚Ä‚¢‚é‚Ģ‚ą‚±‚ź‚É‹ß‚¢‚ą‚ĢB‚»‚±‚É‚Ķ Perl ‚ą Python ‚ą“ü‚Į‚Ä‚éB
ƒCƒ“ƒXƒg[ƒ‹‚·‚éŪ‚Ģ‘I‘šŽˆ‚Å "Core System" ‚š‘I‚ׂĪ Perl ‚ā Python ‚Ķ
“ü‚ē‚Č‚©‚Į‚½‚ĘŽv‚¤‚Æ‚ĒA‚±‚ź‚šƒfƒtƒHƒ‹ƒg‚ĘŒÄ‚Ō‚Ģ‚Ķ‚æ‚å‚Į‚Ę–³—‚Ŗ‚ ‚é‚ĘŽv‚¤‚ķB

‚»‚ź‚ʁAŠČˆÕƒCƒ“ƒXƒg[ƒ‹‚Ę‚©ƒJƒeƒSƒŠ‚ŃfƒXƒNƒgƒbƒv‚Ę‚©^‚ɃfƒtƒH‚ĘŒ¾‚Į‚½•Ø‚Ķ
Solaris ‚É‚Ķ‘¶Ż‚µ‚Č‚¢BDebian ‚Ķ’m‚ē‚ńB

494 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/28(‹ą) 20:11:40
Solaris2.6‚ ‚½‚č‚ĢƒfƒtƒH‚ÅPerl‚Ķ“ü‚Į‚Ä‚½‹L‰Æ‚Ŗ‚ ‚éB
15”N‚­‚ē‚¢‘O‚ĢHP-UX‚¾‚ĘPerl‚Ŗ“ü‚Į‚Ä‚Č‚©‚Į‚½‹L‰Æ‚ŖB

495 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/29(“y) 00:42:19
‰“‚ąHP-UXƒƒCƒ“‚¾‚Æ‚ĒPerl“ü‚Į‚Ä‚Č‚¢‚ķ

496 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/29(“y) 00:47:55
Šm‚©‚ɁASolaris‚ÉŠµ‚ź‚Ä‚¢‚ÄHP-UXŽg‚ķ‚³‚ź‚é‚ĘŽg‚¢‚É‚­‚¢‚ķ[

497 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/29(“y) 07:33:12
‚ĘŒ¾‚¤‚ķ‚ƂŁAUN*XƒT[ƒoŠĒ—ŽŅ‚Ģź‡‚Ķawk‚šŽg‚¦‚é‚ꂤ‚É‚Č‚Į‚Ä‚Ø‚Æ‚ĪŠŌˆį‚¢‚ ‚č‚Ü‚¹‚ń‚ĖB

498 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/29(“y) 10:56:30
ŠĀ‹«‚š‘I‚Ī‚Č‚¢ƒT[ƒoŠĒ—‚¾‚Į‚½‚ēAsh,grep,sed,tr,cut,paste,sort,uniq‚ ‚½‚č‚ŁB
nawk‚Ęgawk‚ĢŽd—l·‚ŖŒ‹\‚ ‚é‚Ģ‚ŁAawk‚ĶŽg‚¢‚É‚­‚¢B

499 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/29(“y) 13:15:51
‚±‚¤‚¢‚¤˜b‘č‚ĢŽž‚ÉSolaris‚Ę‚©HP-UX‚Ķo‚é‚Ģ‚ÉAIX‚Ķo‚Č‚¢ƒCƒ[ƒW

500 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/29(“y) 13:40:55
“ś–{’jŽ™‚Č‚ēHI-UXA“Į‚ÉHI-UX/WE2‚¾‚ėBķŽÆ‚ā‚Ė

501 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/29(“y) 14:15:09
‚¤‚Ž

502 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/29(“y) 16:56:12
‚¢‚ā‚±‚±‚ĶedƒXƒNƒŠƒvƒg‚Å

503 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/29(“y) 18:47:15
Solaris‚ĶA/usr/bin/awk /usr/bin/nawk /usr/xpg4/bin/awk
3‚Ā•ŹX‚Č‚Ģ‚Ŗ“ü‚Į‚Ä‚½‹C‚Ŗ‚·‚é‚ȁB
‚ŁAˆź”Ō‚Ü‚Ę‚ą‚Č‚Ģ‚Ŗ3”Ō–Ś‚Č‚Ģ‚ŁA‚ę‚»‚©‚ēŽ‚Į‚Ä‚«‚½ƒXƒNƒŠƒvƒg‚ĶAę“Ŗ‚Ģ#!‚š
‘‚«Š·‚¦‚Č‚¢‚Ę‚¢‚Æ‚Č‚¢‚Ę‚¢‚¤AƒJƒIƒX‚ȏó‘Ō‚¶‚į‚Č‚©‚Į‚½‚¾‚ė‚¤‚©B

504 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/29(“y) 19:23:53
>>503
Ž©•ŖƒAƒJƒEƒ“ƒg‚ĢƒpƒX‚Ķ^‚Įę‚É /usr/xpg4/bin/‚šŽ‚Į‚Ä‚«‚Ä‚½‚ķB

505 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/29(“y) 19:25:17
ƒXƒNƒŠƒvƒg‚š‘g‚ŽŽž‚Ķ‚¾‚¢‚½‚¢ nawk ‚šŽg‚¤
‘¼l‚ĢƒXƒNƒŠƒvƒg‚šŠŪƒpƒNƒŠ‚·‚é‹@‰ļ‚Ŗ–³‚¢‚Ģ‚ŃJƒIƒX‚ĶŠ“‚¶‚½Ž–‚Ŗ–³‚¢

506 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/29(“y) 19:32:53
>>505
˜b‚Ģ—¬‚ź‚Ŗ>>497 >>498‚Č‚Ģ‚ŁA‰Ā”Ą«‚Ŗ–ā‘č‚Č‚ń‚¾‚ęB

507 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/29(“y) 19:39:08
ƒEƒ`‚Ķ RHEL ‚Ę Solaris ‚¾‚ƍl‚¦‚ź‚Ī—Ē‚¢‚©‚ēAawk ‚Å–ā‘č‚Ŗ‚ ‚鎞‚Ķ Perl ‚© Python ‚ōĻ‚Ü‚·‚ķ

508 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/01/30(“ś) 05:43:19
#!/usr/bin/env [gn]*awk
‚¾‚ėķl

509 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/01(‰Ī) 10:39:45
shebangs‚É /usr/bin/env ‘‚­‚Ģ‚Į‚Ä‚ ‚ń‚Ü—Ē‚¢‚ĘŽv‚¦‚Č‚¢‚ń‚¾‚ę‚Č‚ 
•””‚Ģˆų”‚Ģˆµ‚¢‚Ę‚©AŠĀ‹«•Ļ”‚š‚»‚±‚܂ŐM—p‚µ‚Ä—Ē‚¢‚ą‚Ģ‚Č‚Ģ‚©‚Ę‚©
‚ ‚Ę /usr/bin/ ‚É env ‚Ŗ‚ ‚邱‚Ę‚Ķ–{“–‚É•ŪŲ‚Å‚«‚é‚Ģ‚©‚Ę‚©
/bin/sh ‚š‘‚¢‚½‚Ł‚¤‚Ŗ—Ē‚¢‚ń‚¶‚į‚Č‚¢‚©‚Į‚ÄŽv‚Į‚Ä‚µ‚Ü‚¤

510 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/01(‰Ī) 11:45:20
‚±‚Ģ˜b‘č‚ą’č”Ō‚¾‚ȁB‘OƒXƒŒ‚Ģ558-564‚Å‚ą‚ā‚Į‚Ä‚½‚¼B‚Ę‚č‚ ‚¦‚øŒ‹˜_‚¾‚Æ‚šˆų—p‚µ‚Ę‚­‚ķB

>’²‚ׂĂŻ‚½‚ē#!‚ɃCƒ“ƒ^[ƒvƒŠƒ^‚Ģˆų”‚š2‚ĀˆČć—^‚¦‚½‚Ę‚«‚Ģ
>‹““®‚ĶOS‚É‚ę‚Į‚Ĉį‚¤‚ꂤ‚¾‚Į‚½B
>
>FreeBSD4.2: 2‚ĀˆČć‚ ‚Į‚Ä‚ą“n‚é(/usrbin/env gawk -f foo)
>Linux(2.6.8): ‹ó”’‚šŠÜ‚ß‚Ä1‚Ā‚Ģˆų”‚Ę‚µ‚Ä“n‚é(/usr/bin/env "gawk -f" foo)
>Soraris(5.8): 2‚Ā‚ßˆČ~‚Ģˆų”‚Ķ–³Ž‹(/usr/bin/env gawk foo)
>
>Œ‹‹Ē/usr/bin/envŽg‚Į‚½‘‚«•ū‚Ķgawk‚ĢƒCƒ“ƒXƒg[ƒ‹ˆŹ’u‚Ģ·‚š
>‹zŽū‚µ‚ꂤ‚Ę‚µ‚Ä‚é‚ń‚¾‚ė‚¤‚ŖA“®ģ‚ĶOS‚É‚ę‚Į‚Ä‚Ä‚ń‚Å‚Ī‚ē‚Ī‚ē
>‚Č‚Ģ‚Å‚ ‚Ü‚č‚ØŠ©‚ß‚Å‚«‚Č‚¢‚Ę‚¢‚¤‚±‚Ę‚¾‚ė‚¤‚©B

511 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/02(…) 00:12:39
ruby ŠEŒG‚Å‚ą—¬s‚Į‚Ä‚é‚Č
ˆÓ–”‚ą”»‚ē‚øu‚Ø‚Ü‚¶‚Č‚¢v‚ʏĢ‚µ‚ÄŽg‚Į‚Ă邤‚æ‚É
“sŽs“`ą‰»‚µ‚Ä‚¢‚­‚ń‚¾‚Č

512 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/03(–Ų) 22:33:59
‚Č‚ŗ gawk ‚É‚Ķ tr ‚Ŗ–³‚¢‚Ģ‚¾
tr("‚`-‚y","A-Z")‚Ę‚©‚µ‚½‚¢‚¼

513 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/04(‹ą) 03:31:02
‚Ā Python

514 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/04(‹ą) 09:10:06
>>512

BEGIN {
hankaku="0 1 2 3 4 5 6 7 8 9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z a b c d e f g h i j k l m n o p q r s t u v w x y z "
zenkaku="‚O‚P‚Q‚R‚S‚T‚U‚V‚W‚X‚`‚a‚b‚c‚d‚e‚f‚g‚h‚i‚j‚k‚l‚m‚n‚o‚p‚q‚r‚s‚t‚u‚v‚w‚x‚y‚‚‚‚ƒ‚„‚…‚†‚‡‚ˆ‚‰‚Š‚‹‚Œ‚‚Ž‚‚‚‘‚’‚“‚”‚•‚–‚—‚˜‚™‚š"
}
{
for (i=0; i<length(hankaku); i+=2) {
gsub(substr(hankaku,i+1,1),substr(zenkaku,i+1,2))
}
}


515 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/04(‹ą) 09:20:39
‚»‚ź‚¾‚Ętr('ab', 'ba')‚Ŗ‚¤‚Ü‚­‚¢‚©‚Č‚¢‚ń‚¾‚ę‚Č‚ŸB


516 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/04(‹ą) 09:54:40
“Æ‚¶Ž–‚¶‚į‚ń


517 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/04(‹ą) 19:22:21
”Ä—p“I‚É‚P‚Āģ‚Į‚Ę‚Æ‚Ī‚¢‚¢‚¶‚į‚ń

518 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/05(“y) 20:23:34
>514‚Ż‚½‚¢‚Čƒxƒ^‘ł悶‚į‚Č‚­‚Ä

A-Z‚ -‚ń

‚±‚¤‚¢‚¤•\‹L‚Å’uŠ·‚·‚é•ū–@‚ ‚éH


519 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/05(“y) 20:37:26
>>518
tr Žg‚¦‚ĪH

520 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/06(“ś) 03:05:39
tr ƒRƒ}ƒ“ƒh‚Į‚ÄŠĀ‹«‚É‚ę‚Į‚ă}ƒ‹ƒ`ƒoƒCƒg‚Ģˆµ‚¢‚Ŗˆį‚ķ‚ĖHƒEƒ`‚Ģź‡
Ubuntu10.04‚É“ü‚Į‚Ä‚étr(GNU coreutils)7.4‚Ķ‚Ē‚¤‚ā‚ē2•¶Žšˆµ‚¢‚É‚µ‚æ‚į‚¤‚ē‚µ‚¢‚Ŗ
MacOSX10.5‚É“ü‚Į‚Ä‚étriƒo[ƒWƒ‡ƒ“”»‚ē‚ń‚ŖmanŒ©‚é‚ĘBSDŒn‚Ū‚¢j‚Ķ1•¶Žšˆµ‚¢‚É‚µ‚Ä‚­‚ź‚½

521 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/06(“ś) 05:00:06
UNICODE = •¶Žš”
mbcs = ƒoƒCƒg”

522 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/07(ŒŽ) 08:10:44
‚ń[‚ʁA‚Ē‚䂱‚ʁH
gnome-terminal‚Ķƒ†ƒjƒR[ƒhŻ’č‚Ģ‚Ķ‚ø‚Č‚ń‚¾‚Ŗc
‘¼‚É‚ā‚ē‚Č‚«‚į‚¢‚Æ‚Č‚¢‚±‚Ę‚Ŗ‚ ‚é‚Į‚Ä‚±‚ʁH

523 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/09(…) 23:11:37
awk++Žg‚Į‚Ä‚él‚¢‚éH
http://awk.info/?doc/dsl/awkplusplus.html

524 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/10(–Ų) 14:20:51
Å‹ßAawk‚Ģ‘¶Ż‚š’m‚č‚Ü‚µ‚½B
‚¢‚ė‚ń‚ČŒ¾Œź‚šG‚Į‚Ä‚ĶĮÜEEEG‚Į‚Ä‚ĶĮÜEEE‚šŒJ‚č•Ō‚µ‚Ä‚¢‚Ü‚µ‚½B
awk‚Ķ‰½‚Ę‚Č‚­ƒ}ƒXƒ^[o—ˆ‚»‚¤‚Č‹C‚Ŗ‚µ‚Ü‚·B
‚±‚ź‚©‚ēŠę’£‚č‚Ü‚·II
‚Q‚T‚U”{‚Ģ–{‚š”‚Ķ“Ē‚ń‚Å‚Ø‚č‚Ü‚·B

525 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/16(…) 02:02:44
gawk‚ŃtƒB[ƒ‹ƒh‚šƒ\[ƒg‚µ‚Ä•\Ž¦‚µ‚½‚¢‚ń‚¾‚Ŗ
{split($0, a);asort(a);for(i=1;i<NF;i++){printf("%s%s", a[i], FS);}printf("%s\n", a[NF]);}
‚ę‚č‚ąƒXƒ}[ƒg‚Č•ū–@‚ ‚éH

$1`$NF‚Ŗ“ü‚Į‚½“ĮŽź”z—ń‚Ż‚½‚¢‚Č‚Ģ‚Ŗ‚ ‚Į‚½‚ē‚¤‚ź‚µ‚¢‚Ģ‚¾‚ŖB

526 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/16(…) 07:22:58
>>525
$i‚Ę‚©‘‚Ƃ邵‘ć“ü‚ą‚Å‚«‚é‚©‚ē
$1`‚š•Ū‘¶‚µ‚Č‚­‚Ä‚¢‚¢‚Ģ‚Č‚ēAŒć”¼‚Ķ

for(i=1;i<=NF;i++){$i=a[i]} print

‚ʏ‘‚Æ‚Ī‚æ‚å‚Į‚Ę’Z‚­‚Č‚é‚ȁB


527 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/16(…) 12:11:40
>>526
‚Č‚é‚Ł‚ĒA‚»‚¤‚Å‚«‚é‚Ģ‚©B‚ ‚č‚Ŗ‚Ę‚¤B

528 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/17(–Ų) 01:07:36
http://www.kt.rim.or.jp/~kbk/gawk-3.1/ ‚É’u‚¢‚Ä‚ ‚Į‚½
win32—pgawk‚Ŗ‚¢‚Ā‚ĢŠŌ‚É‚©ŒöŠJ’āŽ~‚É‚Č‚Į‚Ä‚¢‚½B

wn32‚Ģgensub‚ŖŽg‚¦‚Ä“ś–{Œź‚Ŗˆµ‚¦‚āA
‚©‚Āexe‚Ģ‚Ż‚ʼnŅ“®‚·‚é‚Ģ‚ŃCƒ“ƒXƒg[ƒ‹•s—v‚Č‚Ģ‚Ŗ•Ö—˜‚Å
ŒöŽ„‚É‚ķ‚½‚Į‚Ĉ¤—p‚µ‚Ä‚¢‚½‚Ģ‚ŁA”ńķ‚ɔ߂µ‚¢„„„


529 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/17(–Ų) 02:14:57
http://www.vector.co.jp/soft/win95/util/se376460.html
Ŗ‚Ę‚Ķˆį‚¤‚ĢH

530 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/18(‹ą) 11:30:36
‚»‚ź‚Ķ­‚µŒĆ‚¢.
gawk-mbcs-win32-20090920.zip ‚ŖŽčŒ³‚É‚ ‚é‚Ģ‚Å•K—v‚Č‚ēÄ”z•z‚·‚é‚Ŗ?

531 F528F2011/02/19(“y) 01:36:10
>>530
‚ą‚µŽ„‚ÉŒ¾‚Į‚Ä‚­‚ź‚Ä‚¢‚é‚Ģ‚Å‚ ‚ź‚ĪA
exe‚Ģ‚Ż‚¾‚Æ‚Ē2009/11/24”Å‚ŖŽčŒ³‚É‚ ‚é‚Ģ‚ŁA
‚±‚ź‚šŽg‚¢‘±‚Æ‚ę‚¤‚ĘŽv‚¤B‚ ‚č‚Ŗ‚Ę‚¤B


532 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/19(“y) 08:18:59
‰“‚ĢŽčŒ³‚ɁAgawk-mbcs-win32-20091124.zip ‚Ŗ‚ ‚Į‚½B
—~‚µ‚¢l‚Ŗ‚¢‚āA‚©‚ĀÄ”z•z‚É–ā‘č–³‚¢‚Ę‚¢‚¤Ž–‚Ŗ‚ķ‚©‚ź‚Ī‚Ē‚Į‚©‚É‚¤‚‚·‚é‚ŖB

‚µ‚©‚µ‚Č‚ń‚Å”z•z‚ā‚ß‚æ‚į‚Į‚½‚ń‚¾‚ė‚ĖB
‚Ē‚±‚©‚ē‚©”qŽŲ‚µ‚½ƒR[ƒh‚Ę‚©‚Ģƒ‰ƒCƒZƒ“ƒX–ā‘č‚Č‚Ģ‚©‚ȁH

533 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/19(“y) 22:51:02.65
AWK++‚É‚ę‚éƒIƒuƒWƒFƒNƒgŽwŒü“ü–å
http://ja.wikibooks.org/wiki/AWK%2B%2B%E3%81%AB%E3%82%88%E3%82%8B%E3%82%AA%E3%83%96%E3%82%B8%E3%82%A7%E3%82%AF%E3%83%88%E6%8C%87%E5%90%91%E5%85%A5%E9%96%80

awk++‚Ķ–Ź”’‚»‚¤‚¾‚Æ‚ĒAŒ»ŽĄ‚É‚Ķawk‚ÅOO‚š‚ā‚él‚Ķ‚Ł‚Ę‚ń‚Ē‚¢‚Č‚¢‚¾‚ė‚¤B
‚»‚ą‚»‚ąawkŽg‚¢‚ĶOO‚š—‰š‚Å‚«‚Č‚¢‚—īŽŅ‚Ŗ‚Ł‚Ę‚ń‚Ē‚¾‚µB
‚Å‚ąAgawk‚ŖƒfƒtƒHƒ‹ƒg‚ÅOO‚É‘Ī‰ž‚·‚ź‚Īawk‚ŃIƒuƒWƒFƒNƒgŽwŒü‚·‚él‚ą‘‚¦‚é‚©‚ą‚ĖB

534 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/19(“y) 23:05:51.24
>>533
ƒfƒtƒH‚ŃCƒ“ƒXƒg[ƒ‹‚³‚ź‚éawk‚Å‚Å‚«‚é”ĶˆĶ‚Ģ‚±‚Ę‚µ‚©‚ā‚ē‚Č‚¢‚ę

535 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/20(“ś) 00:59:51.51
“ÆŠ“B„ƒfƒtƒH‚Å‚Å‚«‚é”ĶˆĶ
’·‚ß‚ĢƒXƒNƒŠƒvƒg‚š‘‚¢‚½Ž–‚Ŗ‚ ‚Į‚½‚Ģ‚ÅOO‚ ‚é‚Ę•Ö—˜‚ĘŽv‚¤‚Æ‚Ē
‚ķ‚“‚ķ‚“ƒCƒ“ƒXƒg[ƒ‹‚·‚é‚Č‚ēperlArubyApython‚Ŗ‚ ‚邵‚Č‚Ÿ


536 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/02/22(‰Ī) 10:31:51.00
awk‚ŏ‘‚©‚ź‚½awk++‚Į‚Ä‚Č‚¢‚ĢH

537 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/02(…) 23:14:41.35
gawk‚Å•½‰¼–¼EƒJƒ^ƒJƒi‚Ģ•”•Ŗ‚š”²‚«o‚µ‚½‚¢‚ĘŽv‚Į‚Ä‚Ü‚·B
—į‚¦‚Īuawk‚É‚Ā‚¢‚ÄŒź‚éƒXƒŒv‚¾‚Į‚½‚ē
"‚É‚Ā‚¢‚Ä" "‚éƒXƒŒ" ‚š•Ļ”‚É“ü‚ź‚½‚¢‚Ģ‚Å‚·‚ŖA‚¢‚¢•ū–@‚ ‚č‚Ü‚·‚Å‚µ‚傤‚©H

538 F537F2011/03/02(…) 23:17:39.07
u‚É‚Ā‚¢‚āv‚ʁu‚éƒXƒŒv‚Ķ‚»‚ź‚¼‚ź•Ź‚Ģ•Ļ”‚É“ü‚ź‚½‚¢‚ĘŽv‚Į‚Ä‚¢‚Ü‚·

539 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/02(…) 23:27:45.29
ƒAƒ‹ƒtƒ@ƒxƒbƒgˆČŠO‚Ģ•”•Ŗ‚¾‚Į‚½‚ēAƒAƒ‹ƒtƒ@ƒxƒbƒg‚šFS‚ÉŽw’肵‚Äwhile‚ʼnń‚¹‚Ī‚¢‚¢‚Æ‚ĒA
ŠæŽš‚ą”²‚­‚Ģ‚Ķ“ļ‚µ‚¢‚ȁB
‚»‚ź‚ɁAŽ–ŽĄć•Ļ”‚Ķ–³ŒĄ‚ɐ¶¬‚·‚é‚Į‚ÄŽ–‚©B

540 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/02(…) 23:58:57.50
match‚Ģ‘ę2ˆų”‚É/[‚ -‚ńƒA-ƒ“]+/‚šŽ‚Į‚Ä‚­‚é‚Ę‚©?

541 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/03(–Ų) 13:28:46.50
$0,$1...$NF‚š‰ó‚µ‚Ä‚ą‚¢‚¢‚ń‚¾‚Į‚½‚ēAŽ„‚Č‚ē‚±‚¤‚µ‚Ü‚·B

gsub‚ĢŒŸõ•¶Žš“S‚É‚Ķ³‹K•\Œ»‚šŽg—p‚·‚邱‚Ę‚Ŗ‚Å‚«‚é‚©‚ēA
‚Š‚ē‚Ŗ‚Č‚ĘƒJƒ^ƒJƒiˆČŠO‚Ģ•¶Žš‚šƒXƒy[ƒX‚É’u‚«Š·‚¦‚éB

gsub(/[^[‚Ÿ-‚ńƒ@-ƒ“]/," ")

‚Š‚ē‚Ŗ‚Č‚ĘƒJƒ^ƒJƒiˆČŠO‚Ģ•¶Žš‚Ķ”¼ŠpƒXƒy[ƒX‚Q‚Ā‚É’u‚«Š·‚ķ‚éB
‚ ‚Ę‚ĶNF‚šŒ©‚Ä•\Ž¦‚µ‚½‚¢‚ꂤ‚ɏˆ—‚·‚éB

’ˆÓ‚·‚ׂ«‚ĶAWindows”Å‚ĢV‚µ‚¢ƒo[ƒWƒ‡ƒ“‚Ģ‚ą‚Ģ‚Å‚ĶA
³‹K•\Œ»‚Ę‚µ‚āA‚Š‚ē‚Ŗ‚Č‚š ‚Ÿ-‚ń ‚ŁAƒJƒ^ƒJƒi‚š ƒ@-ƒ“ ‚Å
Žw’č‚Å‚«‚Č‚¢‚ą‚Ģ‚Ŗ‚ ‚č‚Ü‚·B
‚½‚µ‚©ƒ}ƒ‹ƒ`ƒoƒCƒgŠg’£‚ʼn󂳂ź‚½B


542 F537F2011/03/03(–Ų) 14:28:35.14
>541
‚Ü‚¾ŽŽ‚µ‚Ä‚Ü‚¹‚ń‚ŖA—~‚·‚镶ŽšˆČŠO‚šĮ‚µ‚ăSƒjƒ‡ƒSƒjƒ‡‚·‚ź‚Ī‚¢‚Æ‚»‚¤‚Å‚·B
>539-540‚³‚ń‚ą‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚µ‚½B


543 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/03(–Ų) 19:41:21.36
BEGIN {
str = "ƒfƒ“ƒRŠæŽš‚Ī‚ń‚“‚¢Œ³‹Cabcde‚¾‚©‚ē"
c = split(str, a, "[^[ƒ@-ƒ“‚Ÿ-‚ń]")
for (i = c; i>=1; i--) {
if ( a[i] !~ /^$/ ) { print a[i] }
}
}

544 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/03(–Ų) 19:44:47.65
ƒ{ƒP‚©‚Ü‚µ‚½
4s–Ś‚Ķ•’Ź‚É
for ( i = 1; i <=c; i++) {
‚ÅOKB

545 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/03(–Ų) 22:55:52.84
c‚šŽc‚³‚Č‚­‚Ę‚ą
for (i in a){if (a[i]) print a[i]}
‚ÅŠŌ‚ɍ‡‚¤‚ꂤ‚ȁB

546 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/04(‹ą) 01:04:03.52
for-in‚¾‚ʏ‡˜‚Ŗ•Ūį‚³‚ź‚Č‚¢‚ń‚¶‚į‚Č‚©‚Į‚½‚Į‚Æ?

547 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/04(‹ą) 08:34:52.75
for ( i = 1; i in a ; i++) ‚Į‚ď‘‚«•ū‚ą‚Å‚«‚é‚ę


548 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/07(ŒŽ) 14:14:11.11
a1 a1 a1 a2 a2 a3
b1 b1 b1 b1
c1
d1 d2 d2
....

‚Ģ‚ꂤ‚ɁAƒtƒB[ƒ‹ƒh”‚Ŗƒoƒ‰ƒoƒ‰‚ŁAƒtƒB[ƒ‹ƒh‚Ŗˆź’v‚·‚鏼‡‚ą‚ ‚ź‚Ī
ˆź’v‚µ‚Č‚¢ƒf[ƒ^‚Ŗ‚ ‚é‚Ģ‚Å‚·‚ŖAd•”‚š
a1 a2 a3
b1
c1
d1 d2
‚Ģ‚ꂤ‚É‚Ü‚Ę‚ß‚ ‚°‚é‚É‚Ķ‚Ē‚¤‚µ‚½‚ē‚ę‚¢‚Å‚µ‚傤‚©H
‚³‚·‚Ŗ‚ɃOƒO‚Į‚ăRƒsƒy‚Ę‚¢‚¤–ó‚É‚ą‚¢‚©‚øBBB

549 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/07(ŒŽ) 14:31:25.16
>>548
‚¢‚ė‚¢‚ė‚ā‚č•ū‚Ķ‚ ‚é‚ĘŽv‚¤‚Ŗ

awk '{j=0;delete a;for(i=1;i<=NF;i++){if(!a[$i]++){$(++j)=$i}}NF=j;print}'

550 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/07(ŒŽ) 14:53:42.21
‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B
‚»‚ź‚¼‚źA4‚Ād•”ƒf[ƒ^‚Ģ‚ ‚Į‚½‚ą‚Ģ‚Ķ3‚Ā‚ɁA2‚Ā‚Ģ‚ą‚Ģ‚Ķ1‚Ā‚É‚ĘŒø‚Į‚½‚Ģ‚Å‚·‚Ŗ
‚»‚źˆČćŒø‚Į‚Ä‚Ü‚¹‚ńB“Æ‚¶ƒRƒ}ƒ“ƒh‚šŒJ‚č•Ō‚µ‚©‚Æ‚Ä‚Ż‚½‚Ģ‚Å‚·‚ŖA•Ļ‰»‚Ķ‚Č‚©‚Į‚½‚Å‚·B

a1 a1 a1 a1
b1 b1 b1
...‚Ģ•”•Ŗ‚Ŗ
a1 a1 a1
b1 b1
‚É‚Ķ‚Č‚Į‚½‚Ę‚¢‚¤ˆÓ–”‚Å‚·B
‚ą‚¤­‚µ‚Ø‚Ā‚«‚ ‚¢‚¢‚½‚¾‚Æ‚Č‚¢‚Å‚µ‚傤‚©BBB


551 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/07(ŒŽ) 15:06:41.15
ŽčŒ³‚Å‚Ķˆź‚Ā‚É‚Č‚é‚Æ‚Ē‚Č‚ŸBŒ“—‚Ķ‚ķ‚©‚邾‚ė‚¤‚©‚ē‚ ‚Ę‚Ķ‚Ŗ‚ń‚Ī‚źB
s‚²‚Ę‚ÉƒtƒB[ƒ‹ƒh‚Ģ“YŽš‚É‚Ā‚¢‚㋁[ƒv‚·‚é‚Ģ‚Ę˜A‘z”z—ń‚ŏoŒ»ƒ`ƒFƒbƒN‚ŖƒLƒ‚B

% cat hoge.txt
a1 a1 a1 a2 a2 a3
b1 b1 b1 b1
c1
d1 d2 d2
% awk '{j=0;delete a;for(i=1;i<=NF;i++){if(!a[$i]++){$(++j)=$i}}NF=j;print}' hoge.txt
a1 a2 a3
b1
c1
d1 d2


552 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/07(ŒŽ) 15:14:33.26
0610005C13Rik 0610005C13Rik 0610005C13Rik
0610007C21Rik 0610007C21Rik 0610007C21Rik 0610007C21Rik 0610007C21Rik

‚±‚¤‚¢‚¤Š“‚¶‚Ģ•¶Žš—ń‚Č‚ń‚Å‚·‚Ŗ
a1‚Ę‚©b1‚Å—į‚¦‚Ä‚ą‘åä•v‚¾‚Į‚½‚Å‚·‚©H

553 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/07(ŒŽ) 15:38:11.62
‹ó”’‚Å‹ęŲ‚ē‚ź‚½•¶Žš—ń‚Č‚ē‚Č‚ń‚Å‚ą‚¢‚¢‚ŖA‚»‚ĢƒŒƒxƒ‹‚ĢŽæ–ā‚Ŗ
o‚é‚ꂤ‚¶‚į‚ą‚¤‚·‚±‚µŠī‘b‚š•×‹­‚µ‚Č‚¢‚Ę‚¾‚ß‚©‚ą‚Č‚ŸB

554 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/07(ŒŽ) 15:50:13.69
ƒVƒ“ƒOƒ‹ƒNƒI[ƒe[ƒVƒ‡ƒ“Žg—p‚ĢƒTƒ“ƒvƒ‹‚Å–ā‘č‚Č‚¢‚ĘŒ¾‚¤Ž–‚Ķ`
‚t‚m‚h‚wŠĀ‹«‚Č‚Ģ‚©‚ȁ`


555 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/07(ŒŽ) 15:58:11.87
Mac OSX‚Ģƒ^[ƒ~ƒiƒ‹‚šŽg‚Į‚Ä‚Ü‚·B
>>551‚Ķ‚»‚Ģ‚Ü‚Ü‚¤‚Ü‚­“®‚«‚Ü‚µ‚½B
‚¢‚܏ø‡‚ÅŽč“®‚ōģ‹Ę‚µ‚Ä‚Ü‚·‚ŖA‚Ü‚¾z‚š”²‚Ƃ邱‚Ę‚Ŗ‚Å‚«‚Ü‚¹‚ńB
‚ą‚¤Žč‚Ŗ‚Ā‚č‚»‚¤‚Å‚·

556 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/07(ŒŽ) 16:04:33.75
ˆźs–ģ˜Y‚š•Ŗ‰š‚µ‚ăXƒNƒŠƒvƒg‚É‘g‚Ż’¼‚µ‚ĘM‚ź‚Ī“®ģŠm”Fo—ˆ‚é‚ĘŽv‚¤

557 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/07(ŒŽ) 16:21:10.50
‚¢‚Üw‚Ü‚Å‚«‚Ü‚µ‚½B‚ą‚¤‚¾‚ß‚Å‚·B
ˆź‰žAƒtƒ@ƒCƒ‹‚š‚Ø‚¢‚Ä‚Ż‚Ü‚·BBB
http://www5.puny.jp/uploader/download/1299482386.zip
ƒpƒX‚Ķ1234‚Å‚·B

558 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/03/07(ŒŽ) 17:18:15.93
‚Ü‚¾‚ā‚Į‚Ä‚é‚Ģ‚©`
ƒtƒ@ƒCƒ‹‚Ģ@O‚l@‚Ŗ–ā‘č‚Ż‚½‚¢‚¾‚©‚ē
‚b‚q‚k‚e‚Ģƒtƒ@ƒCƒ‹Œ`Ž®‚É•ĻŠ·‚µ‚ďć‚Ģˆźs–ģ˜Y‚Å–ā‘č‚Č‚¢‚Ż‚½‚¢‚¾‚Į‚½‚ęB

559 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/04/19(‰Ī) 03:07:46.46
#•””s‚Ģ“ü—Ķ’†Aę‚Ģs‚Ģ11ƒJƒ‰ƒ€–Ś‚ÉOUT‚ŖŠÜ‚Ü‚ź‚Ä‚¢‚é‚©‚ĀŽŸ‚Ģs‚Ģ11ƒJƒ‰ƒ€–Ś‚ÉIN‚ŖŠÜ‚Ü‚ź‚Ä‚¢‚é2s‚Ŗ‘µ‚Į‚½ŽžA2s‚šo—Ķ
$11~/OUT/{ prev=$0; }
$11~/IN/{
if(prev!=""){ print prev; print; }
prev="";
}


560 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/04/19(‰Ī) 15:55:50.78
# 7.awk
NR >= 2{
if($0 ~ /^>'=+/){
if($0 ~ /~$/){
print "A";
}else{
print "NAA";
}
}else if($0 ~ /^>\^(Q=)+/){
if($0 ~ /~~$/){
print "B";
}else{
print "NAB";
}
}else{
print "NAC";
}
}

7.txt
3
>'======#======~
>^Q=Q=Q=Q=Q=Q=Q=Q=~~
>'===#====~
NAA
NBB
NAA@@@‚Ę‚Č‚éB‰½‚ŁH
A
B
A@@‚Ę‚Č‚Į‚Ä‚Ł‚µ‚¢‚Ģ‚ɁEEEgawk 3.1.7‚Å‚·EE


561 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/04/19(‰Ī) 16:30:51.01
‰“‚ĢŽčŒ³‚Ģgawk 3.1.7‚Å‚ĶŠś‘Ņ’Ź‚č‚ĢŒ‹‰Ź‚É‚Č‚é‚Č‚ B

s––‚Ŗ‚ē‚Ż‚¾‚ʉüsƒR[ƒh‚Ŗˆį‚Į‚Ä‚½‚čŒ©‚¦‚Č‚¢‹ó”’‚Ŗ
“ü‚Į‚Ä‚½‚č‚Ę‚¢‚¤‚Ģ‚Ŗ‚ę‚­‚ ‚é‚Ģ‚ÅŠm”F‚µ‚Ä‚ŻB

562 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/04/19(‰Ī) 16:32:43.45
>>560
‚ ‚Ę

/^>'=+/

‚Į‚ăLƒƒƒvƒ`ƒƒ‚Ę‚©‚µ‚Ä‚é‚ķ‚Æ‚¶‚į‚Č‚¢‚©‚ē+‚Ķ–³‘Ź‚¶‚į‚Č‚¢‚©B


563 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/04/19(‰Ī) 16:45:20.75
>>561
‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚µ‚½B‰üsƒR[ƒh‚šunixŒ`Ž®‚É‚µ‚½‚ēo—ˆ‚Ü‚µ‚½B
”Œć‚Ę‚ą‚ę‚ė‚µ‚­‚ØŠč‚¢’v‚µ‚Ü‚·B

564 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/04/19(‰Ī) 17:00:39.34
>>559

IN‚Ŗ‚ ‚é‚Ę‚«‚É‚µ‚©prev‚ŖƒNƒŠƒA‚³‚ź‚Ä‚¢‚Č‚¢‚©‚ēAOUT‚ŖoŒ»‚µ‚½ˆČ~‚É
•””s‚ŖŒo‰ß‚µ‚Ä‚ąIN‚ŖoŒ»‚·‚é‚Ęprint‚³‚ź‚éƒXƒNƒŠƒvƒg‚É‚Č‚Į‚Ä‚¢‚é‚ęB


565 F559F2011/04/20(…) 01:08:11.06
http://okwave.jp/qa/q6672025.html
‚Ę‚©‚Ģ“ü—Ķ‚šƒCƒ[ƒW‚µ‚Ä‚½‚ą‚Ģ‚Å...

$11~/OUT/{ prev=$0; }
$11~/IN/{
if(prev!=""){ print prev; print; }
}
$11!~/OUT/{ prev=""; }


566 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/01(“ś) 16:22:39.39
http://okwave.jp/qa/q6660984.html
#2—ń–Ś‚Ģ€–Ś‚Ŗdisk1`4‚Ü‚Å•s‘«•”•Ŗ‚Ŗ–„‚Ü‚é‚ꂤ‚É‚µA•s‘«‚µ‚Ä‚¢‚½•”•Ŗ‚Ģ1—ń–Ś‚É‚Ķ‘O‚ĢŽžŠŌA3—ń–Ś‚É‚Ķ0‚Å–„‚ß‚½‚¢
BEGIN{ dt=prevDt="00:00:00"; }
NF>=3{ dt=$1; tgt=$2; n=$3; }
NF==2{ tgt=$1; n=$2; }
{ gapDisp(prevTgt,tgt); disp(dt,tgt,n); prevDt=dt; prevTgt=tgt; }
END{ gapDisp(tgt,"disk1"); }

function disp(dt,tgt,n){ print dt, tgt, n; }
function gapDisp(disk,endDisk, cnt)
{
for(cnt=add(getNo(disk)); cnt!=getNo(endDisk); cnt=add(cnt)) disp(prevDt, sprintf("disk%d", cnt), 0);
}
function add(cnt){ return ((++cnt>4)?(1):(cnt)); }
function getNo(disk){ sub(/disk/,"",disk); return disk; }

567 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/01(“ś) 19:40:09.87
BEGIN { reset() }
NF == 2 { $3 = $2; $2 = $1; $1 = last_t }
{ last_t = $1 }
{ if ($2 < last_disk) { p(); reset() } last_disk = $2 }
{ n[$2] = $3 }
{ for(i in n) { if (i >= $2) { t[i] = $1 } } }
END { p() }
function p() {
for (i = 1; i <= 4; i++) {
d = "disk" i
print t[d], d, n[d]
}
}
function reset() {
for (i = 1; i <= 4; i++) {
d = "disk" i
t[d] = t["disk4"]
n[d] = 0
}
}


568 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/03(‰Ī) 14:58:05.53
ŠŌˆį‚Į‚Ä‚é‚ę
‚µ‚©‚ą’·‚­‚Ä”ü‚µ‚­‚Č‚¢‚ę

569 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/03(‰Ī) 15:13:19.32
http://okwave.jp/qa/q6711117.html
...‚±‚ń‚ČŠ“‚¶‚©‚Ė‚„H@@ awk -f sum.awk ƒf[ƒ^ | sort
----- sum.awk -----
$1!~/¤“X–¼/{ tbl[$1 "," $2]+=$3; }
END{
@for(key in tbl){
@@split(key, item, /,/);
@@print item[1], item[2], tbl[key];
@}
}
-----

570 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/03(‰Ī) 15:33:28.80
>>566
NF==3 {
disp();
for(i=1;i<=4;i++) {
disk_time[i]=$1
disk_val[i]=0
}
disk_val[substr($2, 5, 1)]=$3
}
NF==2 {
disk_val[substr($1, 5, 1)]=$2
}
END{
disp()
}
function disp() {
for(i=1;i<=4;i++) {
if(i in disk_time) printf("%s disk%d %s\n", disk_time[i], i, disk_val[i])
}
}

571 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/03(‰Ī) 16:12:56.67
BEGIN {
    # ę“Ŗ‚Ŗ‚¢‚«‚Č‚č "disk2 15" ‚Ģ‚Ż‚ÅŽn‚Ü‚Į‚½‚肵‚Č‚Æ‚ź‚Ī
    # ‚±‚Ģ‰Šś‰»‚Ķ•s—vB
    a = "00:00:00";
}
NF == 3 {
    if (NR > 1) put();
    a = $1;
    b[$2] = $3;
}
NF == 2 {
    b[$1] = $2;
}
END {
    put();
}
function put(    i) {
    for (i = 1; i <= 4; i++) {
        print a, "disk" i, b["disk" i] + 0;
        b["disk" i] = 0;
    }
}

572 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/03(‰Ī) 16:20:05.55
>>569 awk‚Ģ”z—ń‚Į‚Ä‚Ē‚ź‚­‚ē‚¢Šm•Ū‰Ā”\‚Č‚ĢH
ę‚Ésort‚µ‚½‚ē‚Ē‚¤‚©‚ȁH sort ƒf[ƒ^ | awk -f sum.awk
----- sum.awk -----
$1!~/¤“X–¼/{ if(store==$1 && item==$2) val+=$3; else{ disp(); store=$1; item=$2; val=$3; } }
END{ disp(); }
function disp(){ if(store!="" || item!="") print store, item, val; }
-----

573 F ”E–@’ŸyLv=40,xxxPTz y“Œ“d 76.6 %z Š”‰æyEz F2011/05/04(…) 17:32:38.53
ƒwƒbƒNƒVƒ‡ƒ“

574 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/06(‹ą) 00:54:22.24
$ uname -sr
CYGWIN_NT-6.1 1.7.9(0.237/5/3)
$ awk --version
GNU Awk 3.1.8

‚±‚ĢŠĀ‹«‚ŁA
awk 'BEGIN {for(i=j=1;i<50;++i) {print j; j*=10}}'
‚±‚źŽĄs‚·‚é‚ʁAj‚Ŗ23Œ…’“‚¦‚½‚ ‚½‚č‚©‚ēA‚Ø‚©‚µ‚­‚Č‚é‚ń‚¾‚Æ‚ĒB

awk‚Ģ®”‚Į‚ÄćŒĄ‚ ‚é‚ĢHiƒEƒ`‚¾‚Æ‚©Hj

575 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/06(‹ą) 01:09:59.27
long double•Ó‚č‚Ģø“x‚µ‚©‚Č‚¢‚ęB

576 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/06(‹ą) 09:18:39.10
>>574
‚Ø‚ź‚Ģ‚o‚b‚Å‚Ķ•’Ź‚É 1 ‚©‚ē 1e+048 ‚Ü‚Å•\Ž¦‚³‚ź‚Ü‚·‚ŖBBB

577 F ”E–@’ŸyLv=25,xxxPTz F2011/05/06(‹ą) 09:54:18.77
http://ideone.com/QpAMD

578 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/06(‹ą) 11:30:10.09
>>576
–{“–‚Å‚·‚©I‚ę‚ė‚µ‚Æ‚ź‚ĪŠĀ‹«‚š‹³‚¦‚Ä‚­‚¾‚³‚¢B

>>577
‚ ‚č‚Ŗ‚Ę‚¤B‚±‚±awk‚ą’£‚ź‚½‚ń‚¾BŒ‹‰Ź‚Ŗ’·‚·‚¬‚č¢‚Į‚Ä‚½‚Ģ‚ęB
³‚É‚±‚ń‚ČŒ‹‰Ź‚É‚Č‚éB

POSIX‚Å•Ūį‚³‚ź‚Ä‚éø“x‚Ķ>>575‚Į‚Ä‚±‚ʁH
‚Ä‚±‚Ę‚ĶAawk‚Ķ“ą•”‚Å‚ĶA‘S‚Ä‚Ģ”‚Ŗdoubleˆµ‚¢‚Č‚ĢH

579 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/06(‹ą) 14:20:04.87
>>578
576‚Å‚·BWindowsXP + GNU Awk 3.0.6 + multi-byte extension 1.15 ‚Å‚·B


580 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/06(‹ą) 18:58:28.81
>>579
‚ ‚č‚Ŗ‚Ę‚¤B
‚ ‚Ü‚čˆį‚¢‚Ŗ‚Č‚¢‚ȁBWin7‚ĶŠÖŒW‚Č‚¢‚¾‚ė‚¤‚µB
multi-byte extension‚Ŗ‚»‚Ģ•Ó‚č‚ą˜M‚Į‚Ä‚¢‚é‚Ģ‚©c

‚»‚¤‚¢‚¦‚ĪA1e+048‚Ż‚½‚¢‚ČŽw”‚Å•\Ž¦‚³‚ź‚é‚ĢH
o—Ķ‚Ģ‚Ę‚«ŠŪ‚ß‚é‚©‚ēA‚æ‚į‚ń‚ĘŒvŽZ‚Å‚«‚Ä‚é‚ꂤ‚ÉŒ©‚¦‚é‚Ģ‚©‚ȁB

581 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/06(‹ą) 23:07:48.20
awk‚Å‚Ķ”’l‚Ķ‚·‚ׂÄdouble‚ňµ‚¢‚Ü‚·B
‚Å‚·‚©‚ē‚»‚Ģø“x‚Å‚ ‚é53bit•ŖA‘å‘Ģ15Œ…‚æ‚å‚Į‚Ę‚š’“‚¦‚é‚ʐ³Šm‚Č’l‚š•ŪŽ‚Å‚«‚Ü‚¹‚ńB

23Œ…‚ ‚½‚č‚܂Ő³‚µ‚­•\Ž¦‚Å‚«‚Ä‚é‚Į‚Ä‚Ģ‚Ķ‚ę‚­‚ķ‚©‚č‚Ü‚¹‚ń‚ŖA
3.0.6‚É‚µ‚Ä‚ąo—ĶŽž‚Ģ‘Ž®Žw’č‚Ŗˆį‚¤‚¾‚Æ‚Å“ą•”“I‚É‚Ķ“Æ‚¶‚ꂤ‚É•s³Šm‚Č’l‚É
‚Č‚Į‚Ä‚µ‚Ü‚Į‚Ä‚é‚ĘŽv‚¢‚Ü‚·B


582 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/07(“y) 01:38:55.53
‚¾‚©‚ēAŽĄŽælong double‚Ģø“x‚É‚Č‚Į‚Ä‚¢‚é‚ń‚¾‚Į‚Ä‚ĪB

583 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/07(“y) 11:11:15.94
>>582
uŽĄŽæv‚Ę‚¢‚¤‚Ģ‚Ķ‚Ē‚¤‚¢‚¤ˆÓ–”?

#define AWKNUM double

‚Į‚Ä‚Ģ‚Ŗ‚ ‚邵Along double ‚É‚µ‚Ä‚ą‰¼”•”‚Ķ64bit‚¾‚©‚ē23Œ…‚É‚Ķ‘«‚č‚Č‚¢‚ę?
x87‚ĢƒŒƒxƒ‹‚ÅŠg’£ø“x‚É‚Č‚Į‚Ä‚Ä‚ąA•\Ž¦‚ā‚ē‚Č‚ń‚ā‚ē‚·‚é‚Ę‚±‚ė‚Å”{ø“x‚É
ŠŪ‚ß‚ē‚ź‚æ‚į‚¤‚ĘŽv‚¤‚ń‚¾‚Æ‚ĒB


584 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/07(“y) 13:09:06.68
http://codepad.org/4GaxJcGp
Š®‘S‚Ɉź’vB‚Ē‚¤Œ©‚Ä‚ą double ‚Å‚·B–{“–‚É‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚µ‚½

585 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/07(“y) 21:19:09.46
>>581
‚ ‚¤A‚»‚¤‚Č‚Ģ‚©[B‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B¢‚Į‚½‚Č‚ŸB
10i‚ÅŽĄ”ˆµ‚¦‚Ę‚Ü‚Å‚ĶŒ¾‚ķ‚Č‚¢‚Æ‚ĒA®”‚Ķ—~‚µ‚¢B
”‚š‚¢‚ė‚ń‚ČŒ^‚ňµ‚¦‚鏈—Œn‚Č‚ń‚Ä‚Č‚¢‚©B

586 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/07(“y) 23:01:38.63
>>583
‚ [Along double‚ĘŒ¾‚Į‚½‚Ģ‚ŖŁ‚©‚Į‚½‚ĖB10‚Ģ™p‚Ģź‡‚ĶŽĄŽædouble‚š‘å‚«‚­‰z‚¦‚½ø“x‚É‚Č‚Į‚Ä‚¢‚é‚ĘŒ¾‚¢‚½‚©‚Į‚½B

10‚Ķ2‚Ę5‚ĢĻ‚¾‚©‚ēA10”{‚šŒJ‚č•Ō‚·‚Ę‚«‚ɉ¼”•”‚Ķ5”{‚ø‚Ā‚É‚µ‚©‚Č‚ē‚Č‚¢B
IEEE‚Ģdouble‚Ģø“x‚¾‚Ę5‚Ģ22ę‚Å53ƒrƒbƒg‚šŽg‚¢‰Ź‚½‚·‚Ģ‚ŁA‚»‚±‚Ü‚Å‚ĶŒė·‚Ŗ¶‚¶‚Č‚¢B
Œ¾‚¢Š·‚¦‚ź‚ĪA10‚Ģź‡‚Ķ53ƒrƒbƒg+22ƒrƒbƒgA‘¦‚æ75ƒrƒbƒg•Ŗø“x‚Ŗ‚ ‚é‚ꂤ‚ÉŒ©‚¦‚éB

‚Ü‚ŸA>584‚š10”{‚¶‚į‚Č‚­‚Ä5”{‚É‚µ‚āAdouble‚šlong long‚É‚µ‚Ä%.f‚š%llx‚É‚µ‚ărƒbƒg”‚š”‚¦‚Ä‚Ż‚ź‚Ī‚ķ‚©‚é‚Å‚µ‚åB

587 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/09(ŒŽ) 21:13:05.37
gawk‚Ģƒ†[ƒUƒKƒCƒh‚ɁA‘¼‚Ģˆ—Œn‚Å‚ĶA•W€ƒGƒ‰[‚šŽg‚¤‚½‚߁A
@print "Serious error detected!" | "cat 1>&2"
‚Ę‚¢‚¤•ū–@‚µ‚©‚Č‚¢‚Ę‚ ‚č‚Ü‚·B
gawk‚Ķ/dev/stderr‚š“Į•Ź‚Ɉµ‚¤‚½‚߁A
@print "Serious error detected!" > "/dev/stderr"
‚ʏ‘‚­‚Ģ‚Ŗ“KŲ‚Ę‚ ‚č‚Ü‚·B

‚±‚ź‚É‚ĶA‚Ē‚Ģ‚ꂤ‚Čˆį‚¢‚Ŗ‚ ‚é‚Ģ‚Å‚µ‚傤‚©H
/dev/stderr‚Ŗ‚ ‚éOS‚Č‚ēAcat‚ĢƒvƒƒZƒX‚Ŗ¶¬‚³‚ź‚鑼‚ĶAˆį‚¢‚Ķ‚Č‚¢‚Ģ‚Å‚µ‚傤‚©H
ŠĀ‹«‚āˆ—Œn‚š–ā‚ķ‚ø“®ģ‚³‚¹‚½‚¢‚Č‚ēAć‚Ģ‘‚«•ū‚Ģ•ū‚Ŗ‚ę‚¢‚Ģ‚©A‹C‚É‚Č‚Į‚Ä‚¢‚Ü‚·B

‚ę‚ė‚µ‚­‚ØŠč‚¢‚µ‚Ü‚·B

588 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/10(‰Ī) 00:17:11.81
‘¼‚Ģˆ—Œn‚Į‚āA‘¼‚Ģawk‚Į‚ÄŽ–‚¾‚ęB

/dev/stderr‚Ŗ‚ ‚éOS‚Į‚ÄŽ–‚Ą‚į‚Č‚­‚āA
gawk‚Ķ“ĮŽź‚Čƒtƒ@ƒCƒ‹–¼‚Ę‚µ‚Ä/dev/stderr‚Ę‚©Žg‚¦‚é‚ęA‚Į‚ÄŽ–‚¾‚ęB

‚Č‚Ģ‚Å‘¼‚ĢOS‚Å‚ą gawk ‚¾‚Į‚½‚ēprint‚Ę‚©‚Ģo—Ķęƒtƒ@ƒCƒ‹–¼‚Ę‚µ‚Ä /dev/stderr Žg‚¦‚é‚Į‚Ęb‚¾‚ĖB
/dev/stderr‚Ę‚©‚šƒTƒ|[ƒg‚µ‚Ä‚¢‚Č‚¢gawkˆČŠO‚Ģawk‚Å‚ą“®ģ‚³‚¹‚é‚Č‚ē ƒpƒCƒv‚Ę"cat 1>&2"‚šŽg‚¤•ū–@‚µ‚©‚Č‚¢B‚ŖAWinŒn‚Ķcat‚¾‚Ę...

589 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/10(‰Ī) 09:20:21.36
‚»‚±‚Ü‚Å‚Ģ‚±‚Ę‚š‚·‚é‚Č‚ēPerl/Ruby/Python“™‚Ģ‚æ‚į‚ń‚Ę‚µ‚½
ƒXƒNƒŠƒvƒgŒ¾Œź‚ŏ‘‚¢‚½•ū‚Ŗ‚¢‚¢‚ń‚¶‚į‚Č‚¢‚©‚ȁB‚±‚¤‚¢‚¤
‚Ē‚¤‚Å‚ą‚¢‚¢‚Ę‚±‚ė‚Å”Y‚Ü‚Č‚­‚čĻ‚Ž‚ęB

awk‚Ķawk‚ÅŽčŒy‚ɏ‘‚Æ‚é”ĶˆĶ‚Č‚ē‘¼‚Ģ’Ē‚š‹–‚³‚Č‚¢‚ĘŽv‚¤‚Ŗ
‚»‚Ģ˜g‚š‚Ķ‚Żo‚ꂤ‚Ę‚·‚é‚Ę“r’[‚É‘å•Ļ‚É‚Č‚éB‚»‚±‚ŖŠy‚µ‚¢‚Ę
‚¢‚¤‚Ģ‚Č‚ē–³—‚É‚ĶŽ~‚ß‚Č‚¢‚Æ‚Ēw



590 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/10(‰Ī) 14:35:51.09
>>589
‚»‚¤A‚»‚ź‚ŖŠy‚µ‚¢‚ń‚¾

591 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/11(…) 00:36:20.77
>>588
‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B
cat‚Ŗ‚Č‚¢ŠĀ‹«‚¾‚ʁA‚Ē‚¤‚µ‚ꂤ‚ą‚Č‚¢‚Å‚·‚Ėc

>>589
ƒRƒ“ƒ}‹ęŲ‚č‚Ģƒf[ƒ^‚šAƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚ŏˆ—‚µ‚Ä‚¢‚½‚Ģ‚ŁA
‚»‚ź‚šawk‚ɈŚA‚µ‚Ä‚¢‚Ü‚µ‚½Bˆź”ŌŽčŒy‚¾‚Į‚½‚Ģ‚Å‚·B

‚æ‚Č‚Ż‚ɁA2ŽžŠŌ”¼ˆČć‚©‚©‚Į‚Ä‚¢‚½ˆ—‚ŖA1•ŖˆČ“ą‚É’Zk‚³‚ź‚Ü‚µ‚½B
ƒƒ‰ƒ^B@@@ƒƒ‰ƒ^c

592 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/11(…) 10:19:43.16
C‚ŏ‘‚«’¼‚µ‚½‚ē”•b‚ÅŽĄsŠ®—¹‚Ģ—\Š“‚—

593 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/11(…) 12:14:45.46
‚Ā[‚Ä‚ąawk‚Ę‚©‚»‚Ģ‘¼‚ĢƒXƒNƒŠƒvƒg‚ŃTƒNƒb‚ʏ‘‚Æ‚é‚ꂤ‚Č•¶Žš—ńˆ—‚š
CŒ¾Œź‚Ę‚©‚Å‚Ķ‚ ‚ń‚Ü‚č‘‚«‚½‚­‚Č‚ē‚ń‚ĘŽv‚¤‚¼w

594 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/24(‰Ī) 10:19:27.54
‚Č‚č‚Ü‚¹‚ń

595 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/25(…) 20:17:22.02
‚ ‚Ÿ‚ ‚ ‚Ÿ‚Ÿ‚Ÿ```–³—‚¾‚Į‚½‚©AA–³—‚Č‚Ģ‚©[Ia[0][0] = 1 Ø syntax error

596 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/25(…) 21:58:46.38
>>595
gawk‚Ģź‡ƒCƒ“ƒfƒbƒNƒX‚šSUBSEP(=\034‚ŖƒfƒtƒHƒ‹ƒg)‚š‹²‚ń‚ŃVƒŠƒAƒ‰ƒCƒY‚µ‚½ƒCƒ“ƒfƒbƒNƒX‚Å‘½ŽŸŒ³”z—ń‚š•\Œ»‚·‚é
a[0,0] = 1;
‚Č‚ēOK‚Ģ‚Ķ‚øB‚±‚Ģ‚Ę‚«‚ĢƒCƒ“ƒfƒbƒNƒX‚Ķ"0\0340"‚¾‚©‚ēAa["0\0340"] == 1B

597 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/26(–Ų) 18:46:04.99
>>596
‚ ‚č‚Ŗ‚Ę‚¤BŽn‚ß‚©‚ē‚»‚ź‚šˆÓŽÆ‚µ‚ď‘‚¢‚Ä‚½‚ē‚ę‚©‚Į‚½‚ń‚¾‚Æ‚Ē‚ĖB

god["name"] = "Kaname Madoka"
god["msg"] = "Mahoushoujo ha watashi dakede juubun dayo."
homerun["name"] = "Akemi Homura"
homerun["msg"] = "Madoka ha watashi no yome."
‚±‚ń‚Č•—‚ɏ‘‚¢‚Ä‚¢‚½‚Ģ‚šA

puella_magi["god"] = god
puella_magi["homerun"] = homerun
‚Ż‚½‚¢‚ɂ܂ʂ߂ꂤ‚Ę‚µ‚½‚ēA‚ ‚Ī‚Ī‚Ī‚Ī

awk‚Ģ”z—ń‚Į‚ďˆ—Œn‚É‚ę‚Į‚Ä‚Ķ“Y‚¦Žš‚Ŗ®”‚Ģź‡Aˆ—‚ŖÅ“K‰»‚³‚ź‚Ä‘‚­‚Č‚Į‚½‚č‚·‚é‚Ģ‚©‚ȁH
\‘¢‘Ģ‚Ģ‘ć‚ķ‚č‚Ż‚½‚¢‚ÉŽg‚¢‚½‚©‚Į‚½‚Ģ‚¾‚ŖB

598 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/27(‹ą) 00:57:28.69
name["god"] = "Kaname Madoka"
msg["god"] = "Mahoushoujo ha watashi dakede juubun dayo."
name["homerun"] = "Akemi Homura"
msg["homerun"] = "Madoka ha watashi no yome."

‚Å‚ę‚­‚ĖH

599 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/30(ŒŽ) 21:25:51.88
awk‚Į‚Ä *‚Ē‚ĢŽĄ‘•‚Å‚ą* ˆź“x‚ąŽg‚Į‚½‚±‚Ę‚Ŗ‚Č‚¢•Ļ”‚Ģ“ą—e‚Į‚āAƒXƒJƒ‰‚Č‚ē0‚©""‚É‚Č‚Į‚Ä‚é‚ĢH
•Ļ”‚Ŗˆź“x‚ą‘ć“ü‚³‚ź‚Ä‚¢‚Č‚¢‚±‚Ę‚š”»’č‚·‚邽‚߂ɁA(x==0 && x=="")‚Į‚ď‘‚¢‚ĉ½‚©–ā‘č‚Č‚¢H

600 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/30(ŒŽ) 21:31:52.21
>>599
•]‰æ‚³‚ź‚é‚Ę‚«‚É•Ļ”‚Ŗ‘¶Ż‚µ‚Č‚Æ‚ź‚Īģ¬‚³‚ź‚éB‚Ķ‚ø
”z—ń‚Ģ—v‘f‚Č‚ē in ‚Å’²‚ׂē‚ź‚é‚Æ‚Ē
•Ļ”Ž©‘Ģ‚Ę‚Č‚é‚Ę‚Ē‚¤‚¾‚ė‚¤‚Ė

601 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/30(ŒŽ) 21:32:47.76
>>599
‰½“x‚ą‘ć“ü‚µ‚½ŒćAÅŒć‚É 0 or "" ‚š‘ć“ü‚µ‚½•Ļ”‚Ę‹ę•Ź‚Å‚«‚Č‚¢B

602 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/30(ŒŽ) 23:19:06.92
>>600-601
‚ ‚č‚Ŗ‚Ę‚¤B‹ę•Ź‚Å‚«‚Č‚¢‚Į‚āA‚Ē‚¤‚¢‚¤ó‘Ō‚É‚Č‚é‚ĢH0‚š‘ć“ü‚µ‚½‚ē0‚©"0"‚É•]‰æ‚³‚ź‚éB
‚ ‚ A""‚š‘ć“ü‚µ‚½‚ē0‚©""‚É•]‰æ‚³‚ź‚Ä‘Ź–Ś‚Į‚Ä‚±‚Ę‚©IH

603 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/31(‰Ī) 00:05:27.97
‚ ‚źHŽŽ‚µ‚½‚ē‚Ē‚Į‚æ‚š‘ć“ü‚µ‚Ä‚ą599‚ĢŽ®‚Ķ0‚É•]‰æ‚³‚ź‚½‚ęB‹ę•Ź‚Å‚«‚Č‚¢ƒP[ƒX‚Į‚Ä‚Ē‚¤‚¢‚¤ź‡H

604 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/31(‰Ī) 06:28:27.99
BEGIN {
    # ‰Šś‰»’¼Œć (–¢Žg—p) ‚Ģ•Ļ”‚Ķ”’l (0) ‚Ę•¶Žš—ń ("") ‚Ģ—¼•ū‚ĢŒ^‚šŽ‚ĀB
    print x == 0, x == ""; # —¼•ū‚Ę‚ą^

    x = 0;
    print x == 0, x == ""; # ‘OŽŅ‚Ģ‚Ż^B

    x = "";
    print x == 0, x == ""; # ŒćŽŅ‚Ģ‚Ż^B

    # ‘¼‚Ģ–¢Žg—p‚Ģ•Ļ”‚š‘ć“ü‚·‚é‚Ę "Ä‰Šś‰»" ‚Å‚«‚éB
    x = y;
    print x == 0, x == ""; # —¼•ū‚Ę‚ą^B
}

605 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/05/31(‰Ī) 22:57:53.71
> ‰Šś‰»’¼Œć (–¢Žg—p) ‚Ģ•Ļ”‚Ķ”’l (0) ‚Ę•¶Žš—ń ("") ‚Ģ—¼•ū‚ĢŒ^‚šŽ‚ĀB
IEEE Std 1003.1 ‚Ģ awk ‚Ģ EXTENDED DESCRIPTION ‚Ģ
Variables and Special Variables ‚ɏ‘‚¢‚Ä‚ ‚é‚ĖB uninitialized value ‚Ę‚¢‚¤‚ē‚µ‚¢B
POSIX‚ɏ€‹’‚µ‚Ä‚éawk‚Č‚ē‚±‚¤‚Č‚é‚Ż‚½‚¢‚¾‚Æ‚ĒAƒIƒŠƒWƒiƒ‹‚Ķ’m‚ē‚ńB

Ä‰Šś‰»‚·‚é‚Č‚ē$(NF+1)Žg‚¤‚Ł‚¤‚Ŗ‚¢‚¢‚©‚ą‚ĖB–¢Žg—p‚Ģ•Ļ”‚š—pˆÓ‚µ‚Č‚­‚Ä‚¢‚¢B
‚¾‚Æ‚ĒA‚»‚ź‚Ŗ•K—v‚ȏź–Ź‚ŖŽv‚¢•‚‚©‚Ī‚Č‚¢‚ŖB

ŠÖŒW‚Č‚¢‚Æ‚ĒAabsŠÖ”‚Į‚Ä‚Č‚¢‚ń‚¾‚ĖB•Ź‚É—Ē‚¢‚Æ‚ĒAƒĪ‚āA
0‚ę‚č‘å‚«‚¢Å¬‚Ģ•‚“®¬”“_”‚Ķ’č‹`‚µ‚Ä‚Ä‚Ł‚µ‚¢‚Č‚ B

606 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/06/02(–Ų) 10:09:14.37
>>605
> Ä‰Šś‰»‚·‚é‚Č‚ē$(NF+1)Žg‚¤‚Ł‚¤‚Ŗ‚¢‚¢‚©‚ą‚ĖB–¢Žg—p‚Ģ•Ļ”‚š—pˆÓ‚µ‚Č‚­‚Ä‚¢‚¢B
ƒtƒB[ƒ‹ƒh•Ļ”‚Ķķ‚É•¶Žš—ńŒ^‚ŁA ”’lŒ^‚ĶŽ‚½‚Č‚¢B

607 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/06/02(–Ų) 22:47:31.10
ƒĪ‚Ķatan2(0,-1)‚Å‚¢‚¢‚Ę‚µ‚Ä
u0‚ę‚č‘å‚«‚¢Å¬‚Ģ•‚“®¬”“_”v‚Į‚Ä‚Ē‚¤’č‹`‚µ‚Ä‚¢‚ĀŽg‚¤‚Ģ?

608 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/06/03(‹ą) 13:48:37.95
u0‚ę‚č‘å‚«‚¢Å¬‚Ģ•‚“®¬”“_”v‚Ę‚¢‚¤‚Ģ‚Ŗ‰½‚šŠó–]‚µ‚Ä‚¢‚é‚©‚É‚ę‚éB
ˆČ‰ŗ‚Ģ3Žķ—Ž‚Ŗ‚ ‚éB

(1) Å¬‚Ģ³‚Ģ”ń³‹K”
(2) Å¬‚Ģ³‚Ģ³‹K”
(3) 1.0‚É‘«‚µ‚ÄŠŪ‚ß‚½Œ‹‰Ź‚Ŗ1.0‚ę‚č‘å‚«‚­‚Č‚éÅ¬‚Ģ”

609 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/06/03(‹ą) 23:58:11.26
>>606
‚ ‚æ‚įI‚»‚¤‚Å‚µ‚½B$‚Å–ß‚é‚Ģ‚Ķ•¶Žš—ń‚¾‚Į‚½B
‚»‚ĢŽd—l‘“Ē‚ń‚Å‚é‚ʁANF‚šŠg’£‚µ‚½‚Ę‚«AŒ³X‚Č‚©‚Į‚½Š‚Ķuninitialized value‚É‚Č‚é‚Į‚Ä‚ ‚Į‚½‚Ģ‚ŁB

>>607
‚»‚ź‚Å‚¢‚¢‚ń‚¾‚Æ‚ĒAPI‚Ę‚©‚ÅŽQĘ‚Å‚«‚½‚ē‚ą‚Į‚Ę‚¢‚¢A‚ĘŽv‚Į‚½‚Ģ‚Å‚·B
>>608
”’lŒvŽZ‚Ģ‚½‚߂ɁAC‚ĢDBL_EPSILON‚Ģ‘ć‚ķ‚č‚É‚Č‚é’萔‚Ŗ—~‚µ‚¢‚ȂʁB
”CˆÓ‚Ģø“x‚ÅŠŪ‚ß‚ē‚ź‚éŠÖ”‚ą‚Č‚¢‚Å‚·‚µB

610 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/06/04(“y) 09:41:48.63
DBL_EPSILON‚Ŗ>>608‚Ģ(1)`(3)‚Ģ‚Ē‚ź‚©‚ķ‚©‚ē‚Č‚¢H
”’lŒvŽZ‚ĢŠī–{‚Č‚ń‚¾‚ŖB

611 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/06/10(‹ą) 21:49:33.34
•Ļ”–¼‚Č‚ĒAŽ©‘O‚Å‚ ‚Į‚Ä‚ą‹K‘„‚šˆÓŽÆ‚µ‚Ä‚¢‚é•ū‚¢‚Ü‚·‚©H
awk‚¾‚ʁA‚b•—‚Ŗˆź”Ź“I‚Č‚Ģ‚Å‚µ‚傤‚©H
ˆź”ŌÅ‰‚ŖVBA‚¾‚Į‚½‚Ģ‚ŁA’·‚¢–¼‘O‚ĘČ—Ŗ‚Ŗ¬‚“‚Į‚Ä‚µ‚Ü‚Į‚Ä
Ž©•Ŗ‚ŃCƒ‰ƒCƒ‰‚µ‚Ä‚¢‚Ü‚·B
‚Ż‚Č‚³‚ń‚ĢA’Źķ‚Ģ•Ļ”‚Ķ‚±‚¤A”z—ń‚Ķ‚±‚¤A’萔‚Ķ‚±‚¤A•¶ŽšŒ^‚Ķ‚±‚¤„„„
‚Ę‚¢‚¤‚ą‚Ģ‚šŽQl‚É‚µ‚½‚¢‚Å‚·B


612 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/06/10(‹ą) 22:10:28.97
>>611
ƒVƒXƒeƒ€ƒnƒ“ƒKƒŠƒAƒ“‚šĢ—p‚·‚é‚©‚Ē‚¤‚©”Y‚Ž‚Ł‚Ē‘å‚«‚Č‚ą‚Ģ‚šawk‚ŏ‘‚¢‚½‚±‚Ę‚Ŗ–³‚¢

613 F‚©‚ ‚½F2011/06/13(ŒŽ) 18:37:34.88
A5‚Č‚ķ‚ā‚ ‚Ó‚§t( ())

614 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/06/15(…) 21:51:26.93
>>611
’xƒŒƒX‚¾‚ŖAŒ^_“ą—e‚Ģą–¾_–¼‘O‚Ż‚½‚­‚µ‚Ä‚éB–¼‘O‚Ŗˆź•¶Žš‚¾‚Ę‚»‚Ģ‚Ü‚Ü‚¾‚Æ‚ĒB
ƒOƒ[ƒoƒ‹•Ļ”‚Ęƒ[ƒJƒ‹•Ļ”‚Ģ‚Ē‚Į‚æ˜M‚Į‚Ä‚é‚Ģ‚©•Ŗ‚©‚č‚ā‚·‚¢‚ꂤ‚ɁAƒ[ƒJƒ‹•Ļ”‚Ķ•K‚øl‚ÅŽn‚ß‚é‚ꂤ‚É‚µ‚Ä‚éB
d_per_shouhizei = 5.0‚Ę‚©‚ĖB

615 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/06/20(ŒŽ) 18:37:26.17
gawk‚ÅBINMODE‚šŻ’č‚·‚ź‚ĪƒoƒCƒiƒŠ[‚Ģ“üo—Ķ‚Ŗ‚Å‚«‚é‚Ģ‚Ķ‚ķ‚©‚é‚Ģ‚Å‚·‚ŖA
“ü—Ķ‚³‚ź‚½ƒoƒCƒiƒŠ[‚š16iƒ_ƒ“ƒv‚µ‚Ä•\Ž¦‚·‚é‚É‚Ķ‚Ē‚¤‚µ‚½‚ē‚ę‚¢‚Å‚µ‚傤‚©H
od“™‚ĢŠO•”ƒRƒ}ƒ“ƒh‚šŽg‚¤ˆÓŠO‚É•ū–@‚Ŗ‚ ‚ź‚Ī‚Ø‹³‚¦‚­‚¾‚³‚¢B

616 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/06/20(ŒŽ) 19:17:07.50
printf("%02x\n", $1);

617 F“VŽg ŸuL5esZLBSE F2011/07/05(‰Ī) 00:15:13.83
“ń“x‚Ę˜b‚©‚Æ‚ń‚Č‚ę
‚Ø‘O‚ē‚Į‚Ä‚Ē‚¤‚Ż‚Ä‚ąƒSƒ~‚¾‚ę‚Č


618 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/07/06(…) 14:04:55.24
ƒSƒ~‚ń‚Č‚³‚¢

619 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/07/14(–Ų) 23:55:15.84
>>595
gawk4.0.0‚Åa[0][0]=1‚ą‰Ā”\‚É‚Č‚Į‚½‚¶‚į‚Č‚¢‚©

620 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/07/30(“y) 19:46:15.81
’“‰SŽŅ‚ĢŽæ–ā‚Ő\‚µ–ó‚ ‚č‚Ü‚¹‚ńBˆČ‰ŗ‚Ģ‚ꂤ‚Čƒf[ƒ^‚š
aaa 10
bbb 20
ccc 30
aaa 30
bbb 30
aaa 15
ccc 30
ddd 20
ˆČ‰ŗ‚Ģ‚ꂤ‚É‚Ü‚Ę‚ß‚½‚¢‚Ģ‚Å‚·‚ŖA‚Ē‚¤‚µ‚½‚ē‚¢‚¢‚Å‚µ‚傤‚©H
aaa 55
bbb 50
ccc 60
ddd 25

621 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/07/30(“y) 19:53:38.97
ddd 20 ‚Å‚Ķ‚Č‚¢‚©‚ĘŽv‚¤‚Ŗ‚±‚ń‚ČŠ“‚¶‚©‚Č
awk '{a[$1]+=$2} END {for (b in a) {print b " " a[b]}}' | sort

622 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/07/30(“y) 23:15:27.52
Gawk4‚Č‚ēPROCINFO["sorted_in"]‚ĢŻ’č‚ōŌć‚Ģsort‚Ŗ—v‚ē‚Č‚­‚Č‚é

623 F620F2011/07/30(“y) 23:22:20.03
>621
‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·I‚¤‚Ü‚­‚¢‚«‚Ü‚µ‚½B

624 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/07/31(“ś) 15:24:48.76
gawk‚Ķ‚ą‚¤•ŹŒ¾Œź‚ČƒCƒ[ƒWB•’imawkŽg‚Į‚Ä‚é‚Ę

625 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/16(‰Ī) 22:48:21.64
‚±‚±‚Į‚ж‚«‚Ä‚Ü‚·‚©H

626 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/18(–Ų) 01:56:26.63
¶‚«‚Ä‚Ü‚·‚ń

627 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/19(‹ą) 00:53:44.39
¶‚«‚Ä‚¢‚邱‚Ę‚šŠč‚Į‚ÄŽæ–ā‚šB
WIN32‚ĢEXEˆź‚Ā‚ŁA‰ŗ‚ĢTEST.AWK‚Ŗƒ}ƒgƒ‚‚É“®‚­AWK‚š’T‚µ‚Ä‚¢‚Ü‚·B
‚±‚ź‚ēˆČŠO‚É‚ ‚č‚Ü‚·‚©H

http://hinadori.atnifty.com/~wills/program/gawkm115.zip
http://my.vector.co.jp/servlet/System.FileDownload/download/http/0/376460/pack/win95/util/text/awk/gawk-mbcs-win32-20051223.zip?ds
http://my.vector.co.jp/servlet/System.FileDownload/download/http/0/80308/pack/win95/util/text/awk/mw32r27.lzh?ds

Cygwin”Å‚ąŽŽ‚µ‚½‚Ģ‚Å‚·‚Ŗƒ_ƒ‚Å‚µ‚½B

TEST.AWK
{ gsub("[0-9]","x",$0) ; gsub("æ","ƒ\",$0) ; gsub("T","‚s",$0) ; print }

TEST.DAT
±²³“µ¶·ø¹ŗ»¼½¾æ
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒTƒtƒTƒtƒTƒtƒTƒtƒTƒtƒT
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒTƒtƒTƒtƒTƒtƒTƒtƒTƒtƒT

628 F627F2011/08/19(‹ą) 01:00:20.60
TEST.DAT‚ĶA‹ó”’‚Ŗ“ü‚Į‚Ä‚¢‚Ü‚·B
źƒuƒ‰‚Ģƒ|ƒbƒvƒAƒbƒv‚šƒRƒsƒy‚µ‚ĉŗ‚³‚¢B

629 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/19(‹ą) 06:26:54.92
ƒEƒ`‚É‹A‚Į‚Ä‚©‚ē’²‚ׂĂŻ‚é‚ę

630 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/19(‹ą) 11:02:41.54
>>627|628
cygwin‚Ģawk(GNU Awk 3.1.8)‚Å“®‚­‚Æ‚ĒA‚Ē‚¤‚Č‚é‚Ķ‚ø‚Ŗ‚Ē‚¤“®‚©‚Č‚¢‚ĘŒ¾‚Į‚Ä‚¢‚é?
>627‚Ģtest.dat‚Č‚ēA“–‘Ruƒ\v‚¾‚Æ‚Ŗ•ĻŠ·‚³‚ź‚é‚Æ‚ĒB

631 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/19(‹ą) 11:55:06.25
iCygwin‚Č‚ēUTF8‚¶‚į‚Č‚¢‚Ę‚¤‚Ü‚­“®‚©‚Č‚¢‚Æ‚ĒjShift JIS‚Å“®ģ‚³‚¹‚½‚¢‚Į‚Ä‚±‚Ę‚©‚ȁH
Ž–‘O‚ÉTEST.DAT‚šnkf -w‚É’Ź‚µ‚½‚ē‘Ź–Ś‚©‚ȁB

632 F629F2011/08/19(‹ą) 21:59:57.43
>>627
ƒXƒNƒŠƒvƒg‚ąDAT‚ąSJIS‚ÅŽŽ‚µ‚½‚Æ‚ĒAć‹L3‚Ā‚Ģ‚¤‚æAgawk-mbcs-win32-20051223.zip‚Ķƒ_ƒ‚¾‚Į‚½‚ęB
1s–Ś‚Ŗ‚±‚ń‚Č‚ń‚Č‚éB

±xx“µ¶·øxŗ»xxxƒ\

ŽčŽ‚æ‚Ģ
GNU Awk 3.1.7(windows special Nov 24 2009)
‚ŁA--ctype=SJIS‚ā‚Į‚Ä‚ą“Æ‚¶Œ‹‰Ź‚É‚Č‚é‚ĖB

ƒXƒNƒŠƒvƒgADAT‚šUTF-8‚É‚µ‚āA--ctype=UTF8‚ā‚Į‚ăŠƒ_ƒCƒŒƒNƒg‚µ‚½ƒtƒ@ƒCƒ‹‚Ķ³ķ‚ČŒ‹‰Ź‚Ŗo‚é‚ęB
ƒŠƒ_ƒCƒŒƒNƒg‚µ‚Č‚¢‚ŃRƒ}ƒ“ƒhƒvƒƒ“ƒvƒg‚É•\Ž¦‚³‚¹‚é‚ʉ»‚Æ‚é‚Æ‚ĒB

633 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/19(‹ą) 23:18:25.14
EUC‚Č‚ē”¼ŠpƒJƒi‚ą‚¤‚Ü‚­‚ā‚Į‚Ä‚­‚ź‚é‚ń‚¾‚Ŗc

634 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/24(…) 08:07:37.54
gawk‚ĶƒKƒ“ƒKƒ“‹@”\‚šŠg’£‚µ‚Ä‚é‚Æ‚ĒA
‚»‚ė‚»‚ėOOP‘Ī‰ž‚µ‚Ä‚­‚ź‚Č‚¢‚©‚ȁB
awk++‚Ę‚©‚ ‚é‚Æ‚ĒA•W€‚ÅOOP‚Å‚«‚ź‚Ķ•Ö—˜B

635 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/24(…) 22:44:37.24
> OOP
...‚ą‚Ķ‚āawk‚Å‚ā‚éˆÓ–”‚Ŗ–³‚¢w ‘¼‚É‚¢‚­‚ē‚Å‚ą‚ ‚é•Ź‚ĢŒ¾Œź‚Å‚¢‚¢‚¶‚į‚ń

636 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/25(–Ų) 01:14:17.45
awk‚ɍŻ‚é‚Ę•Ö—˜‚©‚ą‚ĘŽv‚¤‚Ģ‚ĶŽQĘ’l‚­‚ē‚¢‚©‚Č

”z—ń‚āŠÖ”‚Ö‚ĢŽQĘ‚š’l‚Ę‚µ‚ÄŽę‚čo‚µŠi”[‚µ‚½‚č
‹t‚É‚»‚Ģ’l‚©‚ēŒ³‚Ģ”z—ń‚ɃAƒNƒZƒX‚µ‚½‚čŒ³‚ĢŠÖ”‚šŒÄ‚ń‚¾‚čo—ˆ‚é‚Ę
‘Š“–‚É•”ŽG‚Čƒf[ƒ^\‘¢‚Ŗ•\Œ»‰Ā”\‚É‚Č‚éA‚»‚ź‚±‚»OOP‚Į‚Ū‚¢‚±‚Ę‚ą‰Ā”\‚¾‚µ

‚Å‚ą‚ ‚ń‚Ü‚č‚ā‚ā‚±‚µ‚¢‚±‚Ę‚ā‚é‚Č‚ēPerl‚Å‚¢‚¢‚©‚ē•K{‚Å‚Ķ‚Č‚¢‚Ė

637 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/25(–Ų) 02:28:23.99
> ŠÖ”‚šŒÄ‚ń‚¾‚č

•Ļ”‚Ģ’l‚šŠÖ”–¼‚Ę‚µ‚Ä
var = "sage";
@var();
‚Į‚Ä‚Å‚«‚é‚Æ‚ĒA‚»‚ź‚Ę‚Ķˆį‚¤‚Ģ‚ńH




638 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/25(–Ų) 04:07:56.67
‚Ø‚ęA‚ą‚¤‚ ‚é‚Ģ‚©w
Å‹ß‚Ģawk‚Ķ•Ŗ‚©‚ē‚Ė‚¦c‚Į‚Ä‚±‚Ę‚ĶA”z—ń‚Ö‚ĢŽQĘ‚šŽg‚Į‚Ä“ü‚źŽq‚Ģ”z—ń‚Ę‚©Šł‚ɍģ‚ź‚æ‚į‚Į‚½‚č‚·‚é‚Ģ‚©H

639 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/25(–Ų) 10:56:54.36
”z—ń‚Ģ”z—ń‚Ķģ‚ź‚é‚ęBgawk4‚Č‚ēB

640 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/25(–Ų) 19:51:33.84
iL_TMjĢ°Ż

641 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/25(–Ų) 20:52:51.07
class human {
@@property name
@@property sex
@@property age
@@method new(x, y, z) {
@@@@name = x
@@@@sex = y
@@@@age = z
@@}
@@method say() {
@@@@printf("Ž„‚Ķ%sB%dĪ‚Ģ%s‚Å‚·B\n",name, age, sex)
@@}
}
class japanese : human {
@@property name
@@property sex
@@property age
@@method say() {
@@@@printf("Ž„‚Ķ%sB%dĪ‚Ģ%s‚Å‚·B‘Š‚Ķ“ś–{‚Å‚·B\n", name, age, sex)
@@}
}
BEGIN {
@@alice = human.new("ƒAƒŠƒX", "—", 11)
@@taro = japanese.new("‘¾˜Y", "’j", 15)
@@yuka = japanese.new("—R‰Ą", "—", 18)
@@alice.say()
@@taro.say()
@@yuka.say()
}

642 F641F2011/08/25(–Ų) 20:58:10.41
>>635
http://code.google.com/p/lawker/source/browse/fridge/lib/bash/awk%2B%2B/
‚±‚ź‚šŽg‚¦‚Ī‚±‚Ģ’ö“x‚ĢOOP‚Ķ‚Ē‚¤‚É‚©‚Å‚«‚éB
–{“–‚É‚±‚Ģ’ö“x‚Å‚¢‚¢‚©‚ēOOP‚É‘Ī‰ž‚µ‚Ä‚Ł‚µ‚¢B
Žg‚¤l‚Ķ‚Ł‚Ę‚ń‚Ē‚¢‚Č‚¢‚ĘŽv‚¤‚ŖA‘S‚­‚Å‚«‚Č‚¢‚Ģ‚ą¢‚éB

643 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/25(–Ų) 22:07:53.46
‚»‚ź‚ĶÅ‘awk‚Å‚ ‚é•K—v‚Ŗ‘S‚­–³‚¢

644 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/26(‹ą) 06:00:04.19
function Human(self,name,sex,age) {
self["property___name"] = name
self["property___sex"] = sex
self["property___age"] = age
self["method___say"] = "Human___say"
}
function Human___say(self) {
printf "Ž„‚Ķ%sB%dĪ‚Ģ%s‚Å‚·B\n", self["property___name"], self["property___age"], self["property___sex"]
}

function Japanese(self,name,sex,age) {
Human(self,name,sex,age)
self["method___say"] = "Japanese___say"
}
function Japanese___say(self) {
printf "Ž„‚Ķ%sB%dĪ‚Ģ%s‚Å‚·B‘Š‚Ķ“ś–{‚Å‚·B\n", self["property___name"], self["property___age"], self["property___gender"]
}

function methodcall(obj,methodname, m) {
m = obj["method___" methodname]
@m(obj)
}

BEGIN {
Human(alice, "ƒAƒŠƒX", "—", 11)
Japanese(taro, "‘¾˜Y", "’j", 15)
Japanese(yuka, "—R‰Ą", "—", 18)
methodcall(alice,"say")
methodcall(taro,"say")
methodcall(yuka,"say")
}

645 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/26(‹ą) 06:01:35.02
‚²‚ß‚ńˆź•”gender‚É‚Č‚Į‚Ä‚é‚©‚ēsex‚É’¼‚µ‚Ę‚¢‚Ä

‚Ę‚č‚ ‚¦‚øA‚±‚ń‚ČŠ“‚¶‚Ågawk4‚Å‚ąOOPŽ©‘Ģ‚Ķo—ˆ‚é‚ę‚Į‚Ęb

646 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/27(“y) 15:07:17.61
>>644
‚Č‚é‚Ł‚Ē‚Ė[
‚Ę‚Ä‚ą•×‹­‚É‚Č‚č‚Ü‚·

‚Å‚ąA‚ā‚Į‚Ļ‚čOOP—p‚Ģ\•¶‚ŖŽg‚¦‚ź‚ĪƒxƒXƒg‚Å‚·‚Ė
‚»‚Ģ‚Ł‚¤‚Ŗ‚ķ‚©‚č‚ā‚·‚¢‚ĘŽv‚¢‚Ü‚·

647 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/27(“y) 15:58:44.09
‚ā‚Į‚Ļ•ŹŒ¾ŒźŽg‚¤‚ׂ«‚¾‚ė

648 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/27(“y) 16:10:36.72
–{“–‚É—~‚µ‚¢‚ń‚Č‚ēAgawk‚ĢML‚É‚±‚¤‚·‚ź‚ĪOOPŽĄŒ»‚Å‚«‚邱‚Ę‚š”­Œ©‚µ‚½‚ń‚¾‚Æ‚ĒA
‚±‚ź‚Ģ“œˆß\•¶‚š—pˆÓ‚µ‚Ä‚­‚ź‚Į‚Ä“Še‚·‚é‚Ę‚¢‚¢‚ń‚¶‚į‚Ė
switch‚ąŽĄ‘•‚³‚ź‚Ă邵A—~‚µ‚¢l‚Ŗ‹‚é‚Ę•Ŗ‚©‚ź‚Ī•t‚Æ‚Ä‚­‚ź‚é‚©‚ą‚ę

649 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/27(“y) 16:25:08.65
#! /usr/bin/env python
# -*- coding: utf-8 -*-

class human:

@@def __init__(self, name, sex, age):
@@@@self.name = name
@@@@self.sex = sex
@@@@self.age = age

@@def say(self):
@@@@print("Ž„‚Ķ" + self.name + "B" + str(self.age) + "Ī‚Ģ" + self.sex + "‚Å‚·B")

class japanese(human):

@@def __init(self):
@@@@super(human, self).__init__(self)

@@def say(self):
@@@@print("Ž„‚Ķ" + self.name + "B" + str(self.age) + "Ī‚Ģ" + self.sex + "‚Å‚·B‘Š‚Ķ“ś–{‚Å‚·B")

if __name__ == "__main__":

@@alice = human("ƒAƒŠƒX", "—", 11)
@@taro = japanese("‘¾˜Y", "’j", 15)
@@yuka = japanese("—R‰Ą", "—", 18)
@@alice.say()
@@taro.say()
@@yuka.say()

650 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/27(“y) 16:26:25.23
python‚ŏ‘‚¢‚Ä‚Ż‚é‚ʁA
>>641‚Ę”ä‚ׂé‚Ę“Į‚É‚ķ‚©‚č‚ā‚·‚¢‚ķ‚Æ‚Å‚ą‚Č‚¢‚Æ‚Ē
>>644‚ę‚č‚Ķ‚ķ‚©‚č‚ā‚·‚¢

651 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/08/27(“y) 16:53:49.92
‚»‚č‚įawk‚ĶOOPL‚Å‚Ķ‚Č‚¢‚©‚ē‚Č
‚ ‚­‚܂ŃVƒFƒ‹‚Ģ‚Ø‹Ÿ‚Å‚¢‚¢‚ĘŽv‚¤‚ń‚¾
‚»‚µ‚Ä‚»‚±‚ɍ‚“x‚ČOOP‹@”\‚Ķ—v‚é‚Ę‚ĶŽv‚¦‚Č‚¢
‚Ē‚æ‚ē‚©‚ĘŒ¾‚¦‚ĪƒtƒB[ƒ‹ƒh’Šo‚Ę‚©‚š‚ą‚Į‚Ę•Ö—˜‚É‚·‚ׂ«‚¾‚ę

652 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/09/17(“y) 15:34:39.29
cygwinˆČŠO‚Ågawk4.0‚šwindows‚ÅŽg‚Ø‚¤‚ĘŽv‚Į‚½‚ēAƒoƒCƒiƒŠ‚Ķ‚Ē‚±‚Å“üŽč‚Å‚«‚ą‚¤‚·‚©‚ĖH

653 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/09/17(“y) 16:28:58.78
cygwin ‚Å‘Ź–Ś‚Č——R‚Ŗ•Ŗ‚©‚ē‚Č‚¢‚©‚ē‹³‚¦‚ē‚ź‚Č‚¢B

654 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/09/18(“ś) 08:02:36.95
>>652
‚Āhttp://www.klabaster.com/progs/gawk32.zip

655 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/09/19(ŒŽ) 13:00:55.06
>654 ‚³‚ń‚­‚·‚±

>653 awk‚ĢŽĄsŒ`Ž®‚¾‚Æ“üŽč‚·‚ź‚Ī—Ē‚¢‚ꂤ‚É‚µ‚½‚¢‚Ģ‚³B

656 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/09/19(ŒŽ) 14:01:43.39
ƒoƒCƒiƒŠŒŻŠ·‚ĢWindows‚Č‚Ģ‚ɁAcygwin‚Äexe‚š‚ą‚Į‚Ä‚­‚¾‚Æ‚¶‚įŽg‚¦‚Č‚¢‚ĢH

657 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/09/19(ŒŽ) 16:07:37.39
•Ø‚É‚ę‚Į‚Ä‚ĶŽg‚¦‚½‚ꂤ‚Č‹C‚Ŗ‚·‚éB
cygwin1.dll‚¾‚Į‚ƁH‚ɃpƒX‚Ŗ’Ź‚Į‚Ä‚ź‚Ī‘å‘ĢŽg‚¦‚½‚ꂤ‚Č‹C‚Ŗ‚·‚éB

658 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/09/19(ŒŽ) 17:00:12.76
Œ‹\‘ņŽR‚Ģdll‚Ŗ—v‚é‚ę
ƒRƒ}ƒ“ƒh‚É‚ę‚é‚Æ‚Ē

659 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/10/24(ŒŽ) 01:55:49.24
‹³‚¦‚Ä‚­‚¾‚³‚¢B‰pŒź“¾ˆÓ‚Ȑl

http://www.gnu.org/s/gawk/manual/gawk.html#Array-Sorting-Functions
‚Ģ@asort(), asorti()‚ÅŽg‚¤ƒ†[ƒU[’č‹`‚Ģ”äŠrŠÖ”‚É‚Ā‚¢‚Ä
3”Ō–Ś‚Ģˆų”‚ĘPROCINFO["sorted_in"]‚ɐŻ’č‚·‚é‚Ģ‚Ęˆį‚¤‚Ģ‚©“Æ‚¶‚Č‚Ģ‚©H

‚»‚ź‚Ę
http://www.gnu.org/s/gawk/manual/gawk.html#String-Functions
‚ɏ‘‚¢‚Ä‚ ‚é3”Ō–Ś‚Ģˆų”‚Ģą–¾("descending"‚Ę‚©)‚Ŗ—¼—§‚µ‚Ä‚ń‚ĢH

660 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/10/24(ŒŽ) 11:34:13.18
http://www.gnu.org/s/gawk/manual/gawk.html#Array-Sorting-Functions
As with PROCINFO["sorted_in"], this argument may be the name of a user-defined function, ....

http://www.gnu.org/s/gawk/manual/gawk.html#String-Functions
The third argument can also be a user-defined function name ....
‘ęŽOˆų”‚Ģ’l‚Ę“Æ–¼‚ĢŠÖ”‚Ŗ’č‹`Ļ‚Ż‚Č‚ē‚»‚ź‚š—˜—p‚·‚é‚Ę‚©A
‚»‚¤‚¢‚¤•ū–@‚Å‹ę•Ź‚µ‚Ä‚é‚ń‚¶‚į‚Č‚¢‚Ģ

661 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/10/24(ŒŽ) 13:33:04.59
>>659
”äŠrŠÖ”‚Ģ—^‚¦•ū‚ĶPROCINFO["sorted_in"]‚Ģź‡‚Ę“Æ‚¶‚Į‚Ä‚±‚Ę‚¾‚ėB

Ž©•Ŗ‚Å’č‹`‚µ‚½ŠÖ”‚Ģ–¼‘O‚Å‚ą‚¢‚¢‚µA11.2.1.2‚ɏ‘‚¢‚Ä‚ ‚é‚ꂤ‚É‚·‚Å‚É—pˆÓ
‚³‚ź‚Ä‚¢‚é@`‚šŽg‚Į‚Ä‚ą‚¢‚¢B



662 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/11/14(ŒŽ) 21:59:05.28
ŒĀl“I‚É‚ĶAGAWK‚É‚Ķ‚ ‚ʁAC‚ŏ‘‚¢‚½ŠÖ”‚ĢŒÄ‚яo‚µ‚Ę‚¢‚¤‚©
GAWK‚ŌĂŌŠÖ”‚šC‚ŏ‘‚Æ‚é‹@”\‚Ŗ—~‚µ‚¢‚ĘŽv‚Į‚Ä‚é‚ń‚¾‚Æ‚ĒA
‚±‚±Œ©‚éŒĄ‚č¢ŠŌ“I‚É‚Ķ‚ ‚ń‚܂莳—v‚Č‚¢‚ń‚©‚Ė‚„B

‚Ü‚ŸA‚»‚ź‚ā‚é‚­‚ē‚¢‚Č‚ēGAWKŽ©‘Ģ‚É•ĻX‚š‰Į‚¦‚čăRƒ“ƒpƒCƒ‹‚µ‚ė‚Į‚Ä‚±‚Ę‚©‚ą‚µ‚ź‚Č‚¢‚Æ‚ĒB

663 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/11/15(‰Ī) 01:44:31.01
P‚Ę‚©RŽg‚¦Œ¾‚ķ‚ź‚é‚ĘŽv‚¤B

664 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/11/15(‰Ī) 01:58:32.43
>>662
ttp://www.gnu.org/s/gawk/manual/html_node/Dynamic-Extensions.html
‚¶‚įƒ_ƒH«—ˆ“I‚É‚³‚ē‚ÉŠg’£‚³‚ź‚é‰Ā”\«‚Ķ‚ ‚é‚Ż‚½‚¢‚¾‚Æ‚Ē

665 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/12/09(‹ą) 00:35:09.18
Å‹ßawkcard‚š’m‚Į‚襉E‚É’u‚¢‚Ä‚é‚Ģ‚¾‚ŖA“ś–{Œź”Å‚Į‚Ä‘¶Ż‚·‚é‚Ģ‚¾‚ė‚¤‚©B

666 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/12/22(–Ų) 16:57:35.32
ttp://gauc.no-ip.org/awk-users-jp/blis.cgi/DoukakuAWK_271
‚±‚±‚ɏ‘‚¢‚Ä‚ ‚é’Ź‚č‚É‚µ‚Ä‚ą“ś–{Œź‚É–|–󂳂ź‚Ü‚¹‚ń
‚Ē‚¤‚µ‚Ä‚Å‚·‚©H
ŠĀ‹«‚Ķ LinuxMint12 A GNU Awk 3.1.8 ‚Å‚·

667 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/12/22(–Ų) 18:01:49.60
>>666
‚»‚Ģ’Ź‚č‚É‚ā‚Į‚½‚ĘŒ¾‚¤‚Ģ‚Č‚ēA‰½ŒĢpoƒtƒ@ƒCƒ‹‚š’ńŽ¦‚µ‚Č‚¢‚Ģ‚©‚ĖAƒ_ƒ~ƒAƒ“ŒNB

668 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/12/22(–Ų) 18:07:45.38
>>667
po‚Ķģ¬‚µ‚Ü‚µ‚½‚µAmo‚ąŠ’č‚ĢƒfƒBƒŒƒNƒgƒŠ‚É‚ ‚č‚Ü‚·B
po‚ĶŽ©•Ŗ‚Å•ŅW‚µ‚Ä‚ąA‚»‚ĢƒTƒCƒg‚Ģ“ą—e‚šƒRƒsƒy‚µ‚Ä‚ąƒ_ƒ‚Å‚µ‚½B

$ cat gettext.po
#: gettext.awk:10
msgid "********** Count Prime Number **********"
msgstr " ‘f”‚š”‚¦‚é "

#: gettext.awk:14
msgid "2 is a prime number."
msgstr "2 ‚Ķ‘f”‚Å‚·B"

#: gettext.awk:24
msgid "%d is a prime number.\n"
""
msgstr "%d ‚Ķ‘f”‚Å‚·B\n"

$ ls ja_JP/LC_MESSAGES/
gettext.mo

669 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2011/12/22(–Ų) 18:10:02.43
Œ‹‰Ź‚Ķ‚±‚Ģ’Ź‚č‚Å‚·B

$ LC_ALL=ja_JP gawk -f gettext.awk 10
********** Count Prime Number **********
2 is a prime number.
3 is a prime number.
5 is a prime number.
7 is a prime number.

670 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/01/12(–Ų) 13:56:36.33
‚ø‚¢‚Ō‚ńawk‚©‚ē—£‚ź‚Ä‚¢‚Ä‹v‚µ‚Ō‚č‚ÉŽg‚Į‚½‚ē
nawk‚É“ś–{Œź‚ĢƒoƒO‚Ŗ‚ ‚邱‚Ę‚É‚µ‚Ī‚ē‚­‹C‚Ć‚©‚Č‚©‚Į‚½
substr()‚Åutf-8‚ĢƒeƒLƒXƒg‚šŲ‚čo‚·‚Ę‚Ø‚©‚µ‚Č’l‚É‚Č‚é
gawk‚Å‚Ķ’¼‚Į‚Ä‚¢‚é

671 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/01/12(–Ų) 19:50:49.28
‚»‚ą‚»‚ąUTF-8‚É‘Ī‰ž‚µ‚Ä‚½‚Į‚Æ

672 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/01/13(‹ą) 00:28:07.37
ttp://blog.livedoor.jp/corbie/archives/cat_94960.html
Žc”O‚Č‚Ŗ‚ēAƒVƒtƒgJISAUTF-8—¼•ū‚Ő³ķ‚É“®ģ‚µ‚»‚¤‚ČWindows”Ågawk‚ĶŒó•ā‚Ģ’†‚É‚ ‚č‚Ü‚¹‚ń‚Å‚µ‚½B

673 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/01/13(‹ą) 07:52:50.95
Linux‚Å‚Ķ•’Ź‚É“®‚­‚Ŗc

674 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/04/29(“ś) 21:07:39.93
ƒtƒ@ƒCƒ‹–¼‚Ŗ"*.txt"‚Ģˆź——‚šŽę“¾‚·‚é‚Ę‚«A"\.txt"‚Ń}ƒbƒ`‚³‚¹‚é‚ʁA”CˆÓ‚Ģˆź•¶Žš.(ƒhƒbƒg)‚ʉšŽß‚³‚ź‚Ä‚µ‚Ü‚¤‚ń‚Å‚·‚ŖA‚¢‚¢•ū–@–³‚¢‚Å‚µ‚傤‚©H

675 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/04/29(“ś) 22:04:14.36
GNU Awk 3.1.7‚¾‚Ęƒhƒbƒg‚Ƀ}ƒbƒ`‚µ‚½‚Æ‚Ē‚»‚ą‚»‚ąawk‚Ģ˜bH
‹ļ‘Ģ“I‚ɃRƒ}ƒ“ƒh‚Ŗ‚Ł‚µ‚¢‚Č

676 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/04/29(“ś) 22:08:23.01
ŗ˜a‚Ģ Šo‚¦‚½ƒAƒZƒ“ƒuƒ‰‚ĘCŒ¾Œź
‚±‚ź‚Ŗ‚ ‚Į‚½‚©‚ē
‚¢‚Ü‚¾‚ÉŽ©•Ŗ‚Ŗ‘¹‚Č‹ĘŠE‚Å”Ń‚šH‚Į‚Ä‚é

677 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/04/29(“ś) 22:36:10.83
>>676
‚»‚±‚©‚ē‚Š‚‚–‚‚ɍs‚Į‚ăXƒ}ƒzƒAƒvƒŠŠJ”­‚Č‚ē‚ą‚¤ˆź‰Ōē‚¢‚½‚©‚ą‚µ‚ź‚Ü‚¹‚ń‚Ė‚—

678 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/04/29(“ś) 23:09:38.43
”nŽ­‚É‚Ķ–³—

679 F674F2012/04/30(ŒŽ) 18:07:43.22
>>675
ls | awk '{ if( match($0,"\.txt") > 0) print $0 }'
Ŗ‰ļŽŠ‚ĢƒT[ƒoć‚Å‚±‚ń‚ČŠ“‚¶‚Ģ‚±‚Ę‚ā‚ė‚¤‚Ę‚µ‚Ä‚½‚ń‚Å‚·‚ŖA
ugawk: Œx: ƒGƒXƒP[ƒvƒV[ƒPƒ“ƒX `\.' ‚Ķ `.' ‚Ę“Æ“™‚Ɉµ‚ķ‚ź‚Ü‚·v
‚ĘƒƒbƒZ[ƒW‚Ŗo—Ķ‚³‚źAƒhƒbƒg‚Ŗ”CˆÓ‚Ģˆź•¶ŽšH‚ʉšŽß‚³‚ź‚č¢‚Į‚Ä‚¢‚Ü‚µ‚½‚ŖA
Ž©ŒČ‰šŒˆ‚µ‚Ü‚µ‚½B(Ž©‘ī‚ĢLinuxPC‚Å“®ģŠm”F‚µ‚Ü‚µ‚½BGAWK3.1.7‹y‚Ń4.0.1)
"\.txt"‚Å‚Ķ–³‚­‚āA".txt"‚Å—Ē‚©‚Į‚½‚ń‚Å‚·‚ĖB
‚Ø‘›‚Ŗ‚¹‚µ‚Ü‚µ‚½B

‚ą‚µ‚©‚µ‚½‚ēA‰ļŽŠ‚ĢƒT[ƒo(RHEL)‚ĢGAWK‚ŖŒĆ‚­‚ĉšŒˆ‚Å‚«‚Ä‚Č‚¢‚©‚ą‚µ‚ź‚Ü‚¹‚ń‚ŖB

680 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/04/30(ŒŽ) 20:27:16.48
>>679
match() ‚Ģ‘ę“ńˆų”‚É•¶Žš—ń‚š—^‚¦‚½ź‡‚ĶŽ–‘O‚ɐ³‹K•\Œ»‚Ö‚ĢŒ^•ĻŠ·‚Ŗs‚ķ‚ź‚é‚ŖA
‚»‚ĢŪ‚ɃGƒXƒP[ƒv‚ŖŠO‚ź‚Ä /.txt/ ‚Ę“Æ“™‚É‚Č‚Į‚Ä‚µ‚Ü‚¤A ‚Ę‚¢‚¤‚±‚Ę‚©‚ʁB
‚Ā‚Ü‚č "\\.txt" ‚Ę‚·‚é‚©A ³‹K•\Œ»‚Ģ /\.txt/ ‚š—^‚¦‚ź‚Ī‚ę‚¢B

The GNU Awk User's Guide ‚É‚ą‚±‚ĢŒ»Ū‚É‚Ā‚¢‚Ä‚Ģą–¾‚Ķ‚ ‚é‚ŖA
~ !~ ‰‰ŽZŽq‚É‚Ā‚¢‚Ä‚µ‚©G‚ź‚ē‚ź‚Ä‚¢‚Č‚¢B
ttp://www.kt.rim.or.jp/~kbk/gawk-30/gawk_5.html#SEC32

681 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/05/24(–Ų) 00:27:31.74
gawk4.0.2•t‘®‚ĢŒ“”Å‚Å‚Ķmatch‚Ģą–¾‚É‚ą‚»‚Ģ•ÓG‚ź‚ē‚ź‚Ä‚é‚ĖB
http://www.gnu.org/software/gawk/manual/html_node/String-Functions.html#String-Functions
’N‚©‚±‚Ģƒo[ƒWƒ‡ƒ““ś–{Œź‰»‚µ‚Ä‚Č‚¢‚©‚ȁB

682 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/07/12(–Ų) 02:26:40.35
FIFO‚ČŠ“‚¶‚Ģę“ü‚źęo‚µ‚Ģƒoƒbƒtƒ@‚É‚Ķ‰½Žg‚¦‚Ī‚¢‚¢H
‚Ę‚¢‚¤‚©A
Array‚ŁA‚½‚Ę‚¦‚ĪA[3] ‚©‚ēA[8]‚Ü‚Å‚Ģƒf[ƒ^‚šA[1]‚©‚ēA[6]‚É“®‚©‚·‚É‚Ķ‰½‚Ŗˆź”Ō‘‚¢H
‚Å‚«‚ź‚Ī”z—ń‚Ķ‚P‚Ā‚µ‚©Žg‚¢‚½‚­‚Č‚¢‚Ģ‚¾‚ŖA–³—‚¾‚ė‚¤‚©c


683 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/07/12(–Ų) 09:23:22.92
‘¬‚³‚š‹‚ß‚é‚Č‚ē–ˆ“x‘S—v‘f‚ø‚ē‚·‚ę‚čA“Ē‚Żo‚µˆŹ’u‚ʏ‘‚«ž‚ŻˆŹ’u‚Ģ“YŽšŽ‚Į‚Ä
ŠĒ—‚µ‚½•ū‚Ŗ‚½‚¢‚Ä‚¢‘¬‚¢

684 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/07/12(–Ų) 10:14:32.78
awk‚É‚Ķ˜A‘z”z—ń‚µ‚©‚Č‚¢‚µ‚Č

685 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/07/14(“y) 14:35:06.22
ƒŠƒ“ƒOƒoƒbƒtƒ@‚ʼn½‚Ę‚©‚Č‚é‚Č‚ēƒŠƒ“ƒOƒoƒbƒtƒ@‚©‚Č

686 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/07/14(“y) 22:27:17.73
>>682
BEGIN{
@QMAX=3
@QTopPos=0;QTailPos=0;QNum=0;
@deQ();
@enQ("1");deQ();
@enQ("a");enQ("b");enQ("c");enQ("x");deQ();deQ();deQ();deQ();
}
function enQ(PushVal){
@if (QNum+1 > QMAX){print "‚Ø‚Č‚©‚¢‚Į‚Ļ‚¢"; return;}
@nextPos = (QTopPos+1) % QMAX;
@queue[QTopPos] = PushVal;
@QTopPos=nextPosQNum++;
}
function deQ(){
@if (QNum < 1){print "‚©‚ē‚Į‚Ū"; return}
@QNum--;@TailVal=queue[QTailPos]
@QTailPos = (QTailPos +1) % QMAX;
@print TailVal;
@return TailVal;
}

687 F686F2012/07/14(“y) 22:54:06.64
Ŗ‚ĢŒ‹‰Ź‚Ķ‚±‚ń‚ČŠ“‚¶B
>‚©‚ē‚Į‚Ū
>1
>‚Ø‚Č‚©‚¢‚Į‚Ļ‚¢
>a
>b
>c
>‚©‚ē‚Į‚Ū

>>685‚Ģ‘‚¢‚Ä‚¢‚郊ƒ“ƒOƒoƒbƒtƒ@ŽĄ‘•‚Å‚·B
enqueue,dequeue‰ń”‚Ŗ‘½‚¢‚Č‚ēƒŠƒ“ƒOƒoƒbƒtƒ@‚Å—Ē‚¢‚ĘŽv‚¤B
‘å’ļ‚Ģź‡‚ĶQMAX‚É‘å‚«‚Č’l‚šŻ’č‚·‚ź‚ĪŽ–‘«‚č‚éƒnƒY‚¾‚Æ‚Ē
ćŒĄ‚ŖŒˆ’č‚Å‚«‚Č‚¢“™‚ĢŽ–ī‚Ŗ‚ ‚ź‚Īdelete array‚šŽg‚Į‚½’Pƒ‚Č”z—ńŠĒ—‚©‚ȁB
‚½‚¾“Y‚¦Žš‚Ŗ”’lćŒĄ‚š’“‚¦‚Č‚¢—l‚ȍH•v‚Ķ•K—v‚¾‚ĖB

688 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/07/15(“ś) 21:09:36.15
ƒŠƒ“ƒO‚Å‚ąćŒĄ‚š’č‚ß‚é‚Ę“ü—ĶƒXƒgƒŠ[ƒ€‚ĢćŒĄ‚Ŗ•s–¾‚ȏź‡‚Ü‚ø‚¢‚±‚Ę‚É‚Č‚é‚Ģ‚ŁAŒ»Ż‚Ķ
A=“ü—ĶArray,CˆźŽž•ŪŠĒ,i,k,n,p
  k=1;C[0]=0;
  for(i=1;i<=A[0];i++){n=0;while(k<i && A[k++]=C[n+=1]);if(n){
  delete C[C[0]+1];C[0]-=n;p=0;while(C[p+=1]=C[n+=1]);}p=1;
  while(match(substr(A[i],p),re)){p+=RSTART-1;n=substr(A[i],p,RLENGTH);
  if(k<i){A[k++]=n;}else{C[C[0]+=1]=n;};p+=RLENGTH;}};n=1;
  while(A[k++]=C[n]){delete C[n++];};A[0]+=C[0]-1;C[0]=0;
‚šŽg‚Į‚Ä‚¢‚éB
re=regexp‚Ę‚µ‚āAArray A‚Ɉź’v‚·‚éƒf[ƒ^‚Ŗ‚ ‚ź‚Ś‚»‚ź‚šŽę“¾AŒ‹‰Ź‚šArray A‚ɏo—ĶAA[0]‚ɍ‡Œv‚Ŗ‹LŚB

‚±‚źˆČćiƒR[ƒhƒTƒCƒYA‚ ‚é’ö“x‚Ģ‘¬“xAƒƒ‚ƒŠ‚ĢŽg—p—Ź‚š‹É—Ķ­‚Č‚­j‚Ę‚¢‚¤šŒ‚ōœK‰»‚Å‚«‚邾‚ė‚¤‚©c
‚¾‚ź‚©—Š‚ŽB
“ü—Ķ‚ʏo—Ķę‚Ŗ“Æ‚¶‚Å‚ąA•Ź‚Å‚ąģ“®‚·‚éƒR[ƒh‚Č‚ē®‚Ģ‚±‚Ę—Ē‚¢‚Ģ‚¾‚Ŗc


689 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/07/17(‰Ī) 00:02:18.87
‚±‚ź‚Ķ‚Š‚Ē‚¢
ƒfƒoƒbƒO‚ąŠg’£‚ą–³—‚¶‚į‚Ė

690 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/07/17(‰Ī) 22:03:00.62
Šī–{“I‚Ɉź“xģ‚Į‚ÄŒć‚Ķ•K—v‚ɉž‚¶‚ăRƒsƒy‚¾‚Ŗ‚ē‚ȁB‘¼‚É‚Ķ
function grep( o, re, p, B, this, a ){
B[0]=0;if(o~"-v"){while((getline v < p)>0){if(!match(v,re))B[B[0]+=1]=v;}return B[0];};
if(o~"-o"){while((getline v < p)>0){a=v;while(match(a,re)){B[B[0]+=1]=substr(a,RSTART,RLENGTH);
a=substr(a,RSTART+RLENGTH);}};return B[0];};while((getline v < p)>0){if(match(v,re))B[B[0]+=1]=v;}return B[0];
}
‚Č‚ń‚©‚ą—Ē‚­Žg‚¤Bgrep("-o","pattern","/var/log",data);‚Ż‚½‚¢‚ČŠ“‚¶‚ŁB‘O‚Ģ‚Ķagrep("-v",pattern,B,C)‚Ģˆź•”•ŖB
“ś‚²‚ė‚Ģƒƒ“ƒe‚Å‚æ‚å‚Į‚Ę‚µ‚½Žčģ‹Ę‚¶‚į‚ß‚ń‚Ē‚¢‚Ģ‘g‚Ž‚Ę‚«‚ɁA‚Ł‚Ś”•Ŗ‚Å‘g‚Ż‚ ‚Ŗ‚é‚Ģ‚ŖŠy‚Č‚ń‚¾‚ęB
ƒTƒuƒvƒƒZƒX‚Ę‚µ‚ÄgrepŒÄ‚яo‚·‚Ģ‚ŖƒRƒXƒg‚©‚©‚鎞‚Ę‚©Aperl‚Ŗ”j‘¹‚µ‚½ó‹µ‚Å‚ĢƒŠƒJƒoƒŠ[ƒXƒNƒŠƒvƒg‚Ę‚µ‚Ä‘g‚ń‚¾‚Ģ‚ŖŒ³‚¾‚Æ‚ĒB
ƒJ[ƒlƒ‹‚³‚¦¶‚«‚Ä‚¢‚ź‚ĪŒć‚ĶawkƒoƒCƒiƒŠ—¬‚µž‚ß‚ĪŽg‚¦Ash‚Ŗ”¼•ŖŽ€‚ń‚Å‚¢‚Ä‚ą‚Č‚ń‚Ę‚©“®‚­‚µB


691 F686F2012/07/21(“y) 23:12:03.74
>>688
BEGIN{
@QMAX=9007199254740991
@QTopPos=QTailPos=QNum=0;
@hitTop=0;
@A[++z]="hoge";
@A[++z]="1 2 3 4 5";
@A[++z]="fuga";
@A[0]=z;
@for(i=1;i<=A[0];i++){
@@p=1;
@@while(match(substr(A[i],p),/[0-9]+/)){
@@@p+=RSTART-1;
@@@enQ(substr(A[i],p,RLENGTH));
@@@p+=RLENGTH;
@@}
@@if(QNum>0){
@@@while(QNum && hitTop<i)A[++hitTop]=deQ();
@@}else{
@@@delete A[i];
@@}
@};
@if(QNum>0) while(QNum)A[++A[0]]=deQ();
@for(z=1;z<=A[0];z++)print "A[" z "]:" A[z];
}


692 F686F2012/07/21(“y) 23:44:24.03
691‚Ģ‘±‚«
‚æ‚Č‚Ż‚ɁAA[1]`A[A[0]]‚šgrep‚µ‚ÄŒ‹‰Ź‚ĶA[1]`A[?]‚É–ß‚·ƒXƒNƒŠƒvƒg‚ĖB
•””Œƒ}ƒbƒ`‚·‚鎖‚Ŗ‚ ‚é‚Ģ‚Å–¢ˆ—s‚šć‘‚«‚µ‚Č‚¢‚ꂤ‚ɃLƒ…[Žg‚Į‚Ä‚éB
function enQ(PushVal){
@if (QNum+1 > QMAX){print "Queue Overflow"; exit;}
@nextPos = (QTopPos+1) % QMAX;
@QBody[QTopPos]=PushVal;
@QTopPos=nextPos
@QNum++;
}
function deQ(){
@if (QNum<1){print "Illigal dequeue"; exit;}
@QNum--;
@TailVal=QBody[QTailPos];
@delete QBody[QTailPos];
@QTailPos=(QTailPos +1) % QMAX;
@return TailVal;
}
ƒŠƒ“ƒOƒoƒbƒtƒ@‚ĢćŒĄ’“‚¦‚½‚ēI—¹‚³‚¹‚Ä‚é‚Æ‚Ē>>688‚ĢŽĄ‘•‚ąćŒĄ’“‚¦‚½‚ēƒoƒO‚邵‹–‚µ‚āB
Œv‚Į‚Ä‚Č‚¢‚Æ‚Ēƒ‹[ƒv‚Ŗ‚Č‚¢•Ŗ‘‚¢”¤BƒR[ƒhƒTƒCƒY‚Ķ‚ØŽ@‚µB
ƒƒ‚ƒŠ‚ĶA[]‚Ƀf[ƒ^•ų‚¦‚Ă鎞“_‚ŃAƒEƒg‚ČŠ“‚¶‚¾‚Æ‚ĒA[]‚š“K‹XĮ‚·‚ꂤ‚É‚µ‚Ę‚¢‚½B
o—Ķę‚š•Ź‚É‚µ‚½‚¢‚Č‚ēA[]‚ÉdeQ()‚¹‚ø•Ź•Ļ”‚É‚·‚ź‚Ī‚Ø‚‹B
‚±‚ź‚Å—Ē‚¢H

693 F688F2012/07/22(“ś) 09:36:17.43
>QMAX=9007199254740991
ƒƒƒ^www
‰“‚Ģ‚ąŠm‚©‚Éwhile(C[p+=1]=C[n+=1]);‚Ģ•”•Ŗ‚Å•ŪŽ‚µ‚Ä‚é‚Ģ‚·‚ׂďĮ”ļ•Ŗ‚¾‚Əć‚ɈŚ“®‚³‚¹‚Ä‚é‚Ģ‚Ŗ–³‘Ź‚Č‚Ģ‚Å
‚»‚Ģƒ‹[ƒv‚Ŗ–³‚¢•Ŗ‚ĶŠm‚©‚É‘‚¢‚Ķ‚øB

‚ ‚ʁA’p‚ø‚©‚µ‚Č‚Ŗ‚ēq‚Ė‚½‚¢‚Ģ‚Å‚·‚ŖA‰“>>688‚ĢŽĄ‘•‚ÅćŒĄ’“‚¦‚½‚ēƒoƒO‚é‚škwsk
‚Č‚ń‚©Œ©—Ž‚Ę‚µ‚Ä‚½‚Ģ‚©”X‚Č‚Ŗ‚ēS”z‚É‚Č‚Į‚Ä‚«‚½B
Ģģ‚Į‚½‚ā‚Ā‚Č‚ń‚ŁAŒ‹\‚Č•p“xŽg‚Į‚Ä‚«‚½‚Ģ‚¾‚Ŗ”‚܂ŃoƒO‚É‹C‚Ć‚©‚Č‚©‚Į‚½

‚µ‚©‚µƒf[ƒ^‚šƒƒ‚ƒŠć‚É“WŠJ‚·‚é‚©‚ē‚Ē‚¤‚µ‚Ä‚ąćŒĄ‚Ŗo‚Ä‚­‚é‚ȁc
awk‚Å10GB‚®‚ē‚¢‚Ģˆµ‚¤Žž‚Ķgetline‚Å‚Č‚ń‚Ę‚©‚Č‚é‚Æ‚ĒA‚ā‚Ķ‚čƒƒ‚ƒŠƒ}ƒbƒv‚āƒ|ƒCƒ“ƒ^‚ŖŽg‚¦‚½‚ē•Ö—˜‚¾‚ę‚Č‚Ÿ
ƒpƒbƒ`ģ‚Į‚½‚ēŽł—v‚ ‚é‚©‚ȁH

694 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/07/22(“ś) 11:41:46.83
>>693
691A‚æ‚å‚Į‚Ę’ł³B–³‘Ź‚ɃLƒ…[Žg‚¤•ŖAŒ³ƒXƒNƒŠƒvƒg‚©‚ē—ņ‰»‚µ‚Ä‚½B
> @@@p+=RSTART-1;
>-@@@enQ(substr(A[i],p,RLENGTH));
>+@@@if(hitTop+1<i){
>+@@@@A[++hitTop]=substr(A[i],p,RLENGTH)
>+@@@}else{
>+@@@@enQ(substr(A[i],p,RLENGTH));
>+@@@}
> @@@p+=RLENGTH;
‚ ‚ʁA—Ē‚­l‚¦‚½‚ēo—Ķę‚š•Ź‚É‚·‚é‚Č‚ēA‚»‚ą‚»‚ąƒLƒ…[•s—vB

ƒoƒO‚Į‚Ä‚Ģ‚Ķ687‚Ő”’lćŒĄ‰]X‚ʏ‘‚¢‚½‚Ę‚Ø‚čA
hC[0]+=1h‚Ŗawk‚Ģ®”‚Ģø“xŒė·‚Č‚µ‰‰ŽZ‰Ā”\ćŒĄ‚šl—¶‚µ‚Ä‚¢‚Č‚¢‚¾‚ƁB
‚Ē‚Ģawk‚ą‘½•Ŗ‚»‚¤‚¾‚ĘŽv‚¤‚Æ‚ĒAŽčŒ³‚ĢŠĀ‹«‰ŗ‚Å‚ĢŽĄsŒ‹‰Ź«
C:\>gawk --version
GNU Awk 3.1.7(windows special Nov 24 2009)
C:\>gawk "BEGIN{print 9007199254740990+1}" nul
9007199254740991
C:\>gawk "BEGIN{print 9007199254740991+1}" nul
9007199254740992
C:\>gawk "BEGIN{print 9007199254740992+1}" nul
9007199254740992

ŽĄŪ‚Ķihdd‚āƒƒ‚ƒŠ‚Ŗę‚ÉŽ€‚Ź‚Ģ‚Łj
ˆźs‚Å‚±‚ź‚¾‚Ɛ³‹K•\Œ»‚Ŗhit‚·‚鎖‚ĶŽ–ŽĄć–³‚¢‚µA
‰¼‚É”­¶‚µ‚Ä‚ąŒŸõŒ‹‰Ź‚Ŗ’ׂź‚邾‚ƂŁA‹C•t‚©‚Č‚¢”¤B


695 F688F2012/07/22(“ś) 13:39:49.16
>9007199254740992
—˜_ćA8192ƒyƒ^ƒoƒCƒg‚Ģ“Æ‚¶ƒf[ƒ^[aaa...]‚Åregexp="."‚Ę‚·‚ź‚ĪA”­¶‚·‚é‚ȁc
IEEE 754‚Ģ52bit§ŒĄ‚¾‚©‚ēA‚±‚źˆČć‚Ģ‚Å‚©‚¢”Žšˆµ‚¤‚Č‚ēbig numbert‘Ī‰ž‚Ģƒ‰ƒCƒuƒ‰ƒŠ‚©,
"bc -q" |& ‚Å“®‚©‚·‚©AxgawkAdnawk‚ ‚½‚čŽg‚¤‚ׂ«‚¾‚Č‚Ÿ

Ģ’N‚©‚Ŗbignum‚ĢawkƒXƒNƒŠƒvƒg‘‚¢‚Ä•ś—¬‚µ‚Ä‚¢‚½Šo‚¦‚Ŗ‚ ‚é‚Ģ‚¾‚ŖA
ƒOƒOƒb‚Ä‚ąŒ©‚Ā‚©‚ē‚ńBŽčŒ³‚É‚ ‚é‚Ģ‚Ķƒrƒbƒg‰‰ŽZ‚Ģ‚ā‚Ā‚¾‚Æ‚¾‚ķ
‚¢‚Ā‚©‚»‚ź‚¾‚Æ‚Ģƒf[ƒ^‚šƒƒ‚ƒŠć‚É•ŪŽ‚Å‚«‚éƒ}ƒVƒ“‚šˆµ‚Į‚Ä‚Ż‚½‚¢‚ą‚Ģ‚¾c

696 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/08/03(‹ą) 02:35:23.75
awk‚Į‚Äabs‚Ę‚©acos‚Č‚Ē‚ĢŠī–{“I‚ČŽZpŠÖ”‚Ŗ—pˆÓ‚³‚ź‚Ä‚Č‚¢‚ń‚Å‚·‚Ė
”Œć‚ąŽĄ‘•‚³‚ź‚邱‚Ę‚Ķ‚Č‚¢‚ń‚Å‚µ‚傤‚©H

ƒpƒCƒv‚ŃTƒNƒb‚Ę‚Ā‚Č‚¢‚яƒ“ƒ‰ƒCƒ“‚ŏˆ—‚·‚é‚Ģ‚ɏd•ó‚µ‚Ä‚½‚ń‚Å‚·‚ŖEEE
‘ć‚ķ‚č‚Ę‚Č‚é‚ʁA‰½Žg‚¤‚Ģ‚Ŗ‚ę‚ė‚µ‚¢‚Å‚·‚©H
‚Å‚«‚ź‚Īperl‚ĶŽg‚¢‚½‚­‚Č‚¢‚Å‚·i‚Ē‚¤‚µ‚Ä‚ąD‚«‚É‚Č‚ź‚Č‚¢

697 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/08/03(‹ą) 06:48:38.25
abs‚ĶŽ©•Ŗ‚ŏ‘‚Æ‚Ī‚¢‚¢‚µAacos(x)‚Ķatan2(x, ć(1.0 - x*x))‚ʏ‘‚Æ‚é‚©‚ēA
‚Ē‚æ‚ē‚ąŠī–{“I‚Å‚Ķ‚Č‚¢‚Ę”»’f‚µ‚Ä‘g‚Żž‚Ż‚¶‚į‚Č‚¢‚ń‚¾‚ĘŽv‚¤‚Æ‚ĒB

Python‚©Ruby‚Å‚¢‚¢‚ń‚¶‚į‚Č‚¢H@ƒƒ“ƒ‰ƒCƒi[Œü‚«‚Å‚Ķ‚Č‚¢‚Æ‚ĒB

698 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/08/03(‹ą) 07:37:24.41
>>696
ƒ‰ƒCƒuƒ‰ƒŠ(?)‚šE‚Į‚Ä—ˆ‚Ä‚Ķ?

699 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/08/03(‹ą) 11:48:03.19
>>696
•K—v‚Ȋ֐”’l‚šŒvŽZ‚·‚邾‚Æ‚ĢƒvƒƒOƒ‰ƒ€‚šC‚ōģ‚Į‚Ä‚Ø‚¢‚½‚ē?

700 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/08/03(‹ą) 20:21:59.43
Ģ‚»‚ź‚ŃxƒNƒgƒ‹‰‰ŽZ‚µ‚Ä—V‚ń‚¾‚Č

701 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/08/04(“y) 09:23:47.83
Ruby‚Ķ‚»‚±‚»‚±ƒƒ“ƒ‰ƒCƒi[‚ą‘‚Ƃ銓‚¶‚Ŗ‚·‚éAawk‚āPerl‚Ł‚Ē‚¶‚į‚Č‚¢‚Æ‚Ē‚Ė
Python‚Ķ—¬Ī‚ɃR[ƒh‹N‚±‚³‚Č‚¢‚ʐh‚¢‚±‚Ę‚Ŗ‘½‚¢‚Ŗ

702 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/08/04(“y) 10:27:49.07
awk‚Åmatlab‚Ż‚½‚¢‚ČƒxƒNƒgƒ‹‰‰ŽZ‚Å‚«‚é‚ꂤ‚É‚µ‚Ä‚Ł‚µ‚¢

703 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/08/04(“y) 16:48:36.10
awk‚ŃNƒ‰ƒX‚šŽg‚¦‚é‚ꂤ‚É‚µ‚Ä‚Ł‚µ‚¢

704 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/08/04(“y) 17:06:19.06
awk‚Å‘S‚Ä‚Ģ–‚–@­—‚š‹~‚Į‚Ä‚Ł‚µ‚¢

705 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/08/04(“y) 17:08:30.07
awk‚³‚ń‚Ķ–‚—

706 F–{“cF2012/08/05(“ś) 07:21:28.03
Awk++
http://awk.info/?doc/dsl/awkplusplus.html
OO in AWK++
The awk++ language provides object oriented programming for AWK that includes:
classes
class properties (persistent object variables)
methods
inheritance, including multiple inheritance

http://lawker.googlecode.com/svn/fridge/lib/bash/awk++/version21/awkpp21.zip


707 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/08/05(“ś) 09:56:26.63
ƒfƒoƒbƒO‘å•Ļ‰ß‚¬‚ÄŽ€‚Ź‚é
$ cat witch.awkpp
class Witch {
var spell
method new() { spell = "mahalic mahalita" }
method perform() { print spell }
}
class Samantha : Witch {
method perform() { print "twitch" }
}
BEGIN {
# wife = Witch.new() ƒGƒ‰[—vˆös
wife = Samantha.new()
wife.perform()
}
$ gawk -f awkpp -r witch.awkpp
gawk: -:10: () ƒGƒ‰[—vˆös
gawk: -:10: ^ syntax error
gawk: -:10: () ƒGƒ‰[—vˆös
gawk: -:10: ^ •\Œ»‚Ģ char '?' ‚Ķ•s³‚Å‚·B

708 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/08/22(…) 00:09:49.86
size: 656 byte, supports -o -v option. Array A and B can be the same (NEW)
function xagrep( o, re, A, B, this, a, i,k ){
k=0;B[0]=A[0];if(o~"-v"){for(i=1;i<=A[0];i++){if(!match(A[i],re)) B[k+=1]=A[i];}B[0]=k;return k};
if(o~"-o"){B[B[0]+1]=0;for(i=1;i<=A[0];i++){a=A[i];if(i==k){i=i-B[B[0]+1]+1;B[B[0]+1]=k;k=B[0]+2;
while(i<=B[B[0]+1]){B[i++]=B[k];delete B[k++];}i=B[B[0]+1];k=i;B[B[0]+1]=0;}while(match(a,re)){
if(i>k){B[k+=1]=substr(a,RSTART,RLENGTH);}else{B[B[0]+1+(B[B[0]+1]+=1)]=substr(a,RSTART,RLENGTH);
k++}a=substr(a,RSTART+RLENGTH)}}if(i<k){i=k-i;k=B[0]+1;B[0]=i+B[B[0]+1];while(i<B[0])B[i+=1]=B[k+=1];
while(i<k)delete B[i+=1];}return B[0]}for(i=1;i<=A[0];i++){if(match(A[i],re))B[k+=1]=A[i];}B[0]=k;return k;
}
‚±‚źˆČćķ‚ź‚é‚Ę‚±‚ė–³‚¢‚©‚ȁH@
‚‘¬‰»{ƒTƒCƒY—Dę‚ŁA•Ļ”‚Ķ‚Å‚«‚邾‚ÆŽg‚¤”‚š­‚Č‚­‚Ę‚ĢšŒ‚Å

709 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/08/22(…) 09:51:11.01
>>708
‚»‚Ģ3‚Ā‚ĢšŒ‚Ģ—Dę“x‚Ŗ‚ķ‚©‚ē‚ń‚ȁB

Œ‹\“Æ‚¶•”•ŖŽ®‚Ŗ‚ ‚é‚Ģ‚Å•Ļ”‚É“ü‚ź‚½•ū‚Ŗ•Ļ”‚Ķ‘‚¦‚é‚Æ‚Ē’Z‚­‚Ȃ邵
ź‡‚É‚ę‚Į‚Ä‚Ķ‘¬“x‚ą‘¬‚¢‚Ę‚©‚ ‚č‚»‚¤‚¾‚Æ‚Ē‚Ē‚¤‚Č‚ń?

—į‚¦‚ĪB[0]‚Ķ“Į•Ź‚Č—p“r‚Į‚Ū‚¢‚Æ‚Ēx‚Ę‚©1•¶Žš•Ļ”‚É‚µ‚Äreturn‚Ģ’¼‘O‚É
‘‚«–ß‚µ‚½•ū‚Ŗ•¶Žš”‚Ķ‰Ņ‚°‚éB

‚ ‚Ę×‚©‚¢‚Ŗhoge+=1‚ę‚č++hoge‚Ģ•ū‚Ŗ1•¶Žš’Z‚¢‚Ę‚©A‚¢‚ē‚Č‚¢u;v‚Ŗ
Žc‚Į‚Ä‚é‚Ę‚©‹l‚ß‚ŖŠĆ‚¢‚Ę‚±‚ė‚Ŗ‚Ü‚¾‚ ‚é‚ĖB

710 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/09/30(“ś) 22:45:00.64
ˆČ‰ŗ‚Ģ‚ꂤ‚Čƒf[ƒ^‚Ģˆ—‚É‚Ā‚¢‚ÄŽæ–ā‚¢‚¢‚Å‚µ‚傤‚©B
$1‚ÉŒo‰ßŽžŠŌiŽžjA$2‚Ɂu‘¬“xv‚Ŗ‚ ‚ź‚Ī$3‚Ģ”’l‚Ķ‘¬“x‚šA$2$3‚É
uup avudown av‚Č‚Ē‚Ę‚ ‚ź‚Ī‚»‚ĢŽž‚Å‚Ģs“®‚šŽ¦‚µ‚Ü‚·B

‚±‚Ģƒf[ƒ^‚©‚ēupAdown‚ĢźŠ‚š‹‚ß‚½‚¢‚ĘŽv‚¢‚Ü‚·B
‚Ā‚Ü‚čA‰ŗ‚Ģ—į‚ňŚ“®ŠJŽn‚©‚ē‚Ģ‹——£3‚Åup aA‹——£3.5‚Åup bA‚Ę‚¢‚¤‹ļ‡‚Å‚·B
Œo‰ßŽžŠŌ‚Ę‘¬“x‚©‚ēźŠ‚šŒvŽZ‚·‚邾‚Æ‚Å‚·‚ŖB‘¬“x‚š•ĻX‚·‚éƒ^ƒCƒ~ƒ“ƒOE
‰ń”‚Ķ•s’čA‘¬“xƒf[ƒ^‚ʍs“®ƒf[ƒ^‚Ķ‚Ę‚ą‚ÉŒo‰ßŽžŠŌ‡‚É‹L˜^‚³‚ź‚Ä‚¢‚Ü‚·B
‘¬“x•ĻX‚š‚Ē‚¤ˆµ‚¦‚Ī‚¢‚¢‚Ģ‚©A‚æ‚å‚Į‚Ę“Ŗ‚Ŗ‰ń‚č‚Ü‚¹‚ńB

---Œ³ƒf[ƒ^—į---
0 ‘¬“x 10
50 ‘¬“x 20
200 ‘¬“x 25
30 up a
35 up b
40 down a
40 down b
50 up a
70 down a
200 up c
250 down c

---ˆ—Œć---
3 up a
3.5 up b
4 down a
4 down b
5 up a
6 down a
12.5 up c
14.5 down c

711 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/10/01(ŒŽ) 11:28:30.42
‹^–ā‚š’ńŽ¦B
$1‚Ŗķ‚ÉŽž‚Å$2‚Ŗ‘¬“x‚Ģ‚Ę‚«‚Ģ$3‚Ŗ‘¬“x‚Č‚ēA
30 up a‚Ģ‚Ę‚«‚É30 * 10‚Å300 up a‚É‚Č‚é‚ń‚¶‚į‚Č‚¢‚¾‚ė‚¤‚©B
“Æ‚¶‚ꂤ‚ɁA70 down a‚Ģ‚Ę‚«‚É50 * 10 + (70 - 50) * 20‚Å900 down a‚É‚Č‚é‚ń‚¶‚į‚Č‚¢‚¾‚ė‚¤‚©B

$3‚Ŗ‘¬“x(’PˆŹŽžŠŌ“–‚½‚č‚ĢˆŚ“®—Ź)‚Å‚Ķ‚Č‚­’PˆŹˆŚ“®—Ź“–‚½‚č‚ĢŠ—vŽžŠŌ‚Č‚Ģ‚Å‚ ‚ź‚ĪA
30 up a‚Å30 / 10 = 3A70 down a‚Å50 / 10 + (70 - 50) / 20 = 6‚É‚Č‚é‚ń‚¾‚Æ‚Ē‚ĖB

712 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/10/01(ŒŽ) 13:21:34.21
ŽĄ‘•‚µ‚Ä‚Ż‚½B‘¬“x‚Ŗ“r’†‚ɏo‚Ä‚«‚Ä‚ą‚¢‚¢‚ꂤ‚Épos‚š–ˆ‰ńŒvŽZ‚·‚é‚©‚ēŒų—¦ˆ«‚¢‚Æ‚ĒB
--
BEGIN {
sCount = 0;
}
$2 == "speed" {
sTime[sCount] = $1;
sSpeed[sCount] = $3;
++sCount;
next;
}
{
pos = 0;
for (ic = 1; ic < sCount; ++ic) {
if (sTime[ic] > $1) break;
pos += (sTime[ic] - sTime[ic - 1]) / sSpeed[ic - 1];
}
pos += ($1 - sTime[ic - 1]) / sSpeed[ic - 1];
print pos, $2, $3;
}

713 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/10/01(ŒŽ) 20:30:33.48
>>711
‚·‚Ż‚Ü‚¹‚ńA‘OŽŅ‚Å‚·‚ĖB‚Č‚ń‚¾‚ė‚¤A’p‚ø‚©‚µ‚¢B

>>712
‚Č‚Ģ‚ŁAƒAƒNƒVƒ‡ƒ“•”‚Ģ / ‚š * ‚É•Ļ‚¦‚ź‚Ī‚ę‚³‚»‚¤‚Å‚·B

‚Ø“ń•ūA‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B

714 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/12/13(–Ų) 11:40:43.98
awk‚É‚©‚ķ‚é“Æ“™‚Ģ‚ą‚Ģ‚ ‚č‚Ü‚·H

715 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/12/13(–Ų) 13:08:08.26
python

716 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/12/13(–Ų) 13:13:55.85
>>715
awk‚Ż‚½‚¢‚ÉŽg‚¢ŸŽč‚¢‚¢‚Ģ‚©‚ȁH

717 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/12/13(–Ų) 13:18:24.65
—Ē‚¢‚Å‚·‚ę

718 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/12/13(–Ų) 13:24:31.23
>>717
‚ ‚č‚Ŗ‚Ę‚·B•×‹­‚µ‚Ä‚Ż‚Ü‚·

719 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2012/12/13(–Ų) 14:45:25.45
‚Ķ‚¢

720 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/02/06(…) 03:49:18.86
g”CˆÓ‚Ģ‹L†h‚šŠÜ‚ń‚¾ƒVƒFƒ‹•Ļ”‚šawk‚É“n‚·‚±‚Ę‚Ķ‰Ā”\‚Å‚·‚©H‚½‚Ę‚¦‚Ī

[user@localhost ~]$ var='hoge'
[user@localhost ~]$ echo "hoge" | awk -v var="$var" '
$0 ~ var {print var}
END {print var}
'
hoge
hoge

‚±‚±‚ŁAvar‚É$‚šŠÜ‚Ü‚¹‚é‚Ę

[user@localhost ~]$ var='hoge$fuga'
[user@localhost ~]$ echo "hoge" | awk -v var="$var" '
$0 ~ var {print var}
END {print var}
'
hoge$fuga

‚Ę‚¤‚Ü‚­ƒ}ƒbƒ`‚µ‚Ü‚¹‚ń‚Å‚µ‚½BvarŽ©‘Ģ‚Ķ“n‚³‚ź‚Ä‚¢‚é‚Ķ‚ø‚Å‚·‚ŖA‰½‚ŖŒ“ˆö‚Å‚µ‚傤‚©H

721 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/02/06(…) 11:23:41.42
>>720
‚¢‚悬‚傤‚ß‚Ģ‚Š‚¾‚č‚Ŗ‚ķ‚Ģ var ‚ĶA‚Š‚傤‚©‚Ģ‚³‚¢‚É
‚¹‚¢‚«‚Š‚傤‚°‚ń‚Ö‚Ģ‚©‚½‚Ö‚ń‚©‚ń‚Ŗ‚Ø‚±‚Č‚ķ‚ź‚éB

$0 ~ /hoge$fuga/ {print "hoge$fuga"}
END {print "hoge$fuga"}

‚ß‚½‚ą‚¶‚Ę‚Č‚Į‚Ä‚µ‚Ü‚¤‚ą‚Ģ‚ĶA‚¶‚ŗ‚ń‚ ‚é‚¢‚Ķ‚±[‚Ē‚Ģ‚Č‚©‚Å
‚¦‚·‚Ɓ[‚Õ‚·‚é‚Š‚Ā‚ꂤ‚Ŗ‚ ‚éB

722 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/02/06(…) 11:29:22.31
~(ƒ`ƒ‹ƒ_)‚Ģ‰E•Ó‚Ķ³‹K•\Œ»‚Ę‚µ‚ĉšŽß‚³‚ź‚é‚©‚ēA"hoge" ~ /hoge$fuga/ ‚Ń}ƒbƒ`‚·‚é‚ķ‚Æ‚Ŗ‚Č‚¢B
‹t‚É”J‚ėA"hoge$fuga" ~ /hoge/ ‚Č‚ēƒ}ƒbƒ`‚·‚éB

723 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/02/06(…) 11:33:09.61
>>720
>721‚ą>722‚ą‚Ē‚æ‚ē‚ąŒ“ˆöB‚ā‚č‚½‚¢‚±‚Ę‚š‚ę‚­®—‚µ‚ꂤB

724 F720F2013/02/06(…) 15:09:21.72
‚·‚¢‚Ü‚¹‚ńAecho "hoge"‚Å‚Ķ‚Č‚­echo "$var"‚Å‚µ‚½B
‚½‚¾AŒ‹‰Ź‚Ķ>>720‚Ę“Æ‚¶‚Å‚·B

—v‚Ķ“ü—Ķƒtƒ@ƒCƒ‹“ą‚Ģuƒƒ^•¶Žšž‚Ż‚Ģ”CˆÓ‚Ģ•¶Žš—ńv‚šA•Ź‚Ģuƒƒ^•¶Žš‚ʉüsž‚Ż‚Ģ”CˆÓ‚Ģ•¶Žš—ńv‚Å’uŠ·‚·‚éA
‚Ę‚¢‚¤‚Ģ‚šƒƒ^•¶Žš‚ĢƒGƒXƒP[ƒv“™‚Ģ–Ź“|‚ȏˆ—‚š‚¹‚ø‚ɃTƒNƒb‚Ę‚ā‚č‚½‚¢‚Ģ‚Å‚·‚ŖA‚Å‚«‚Ü‚·‚©H

725 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/02/07(–Ų) 05:01:43.19
ŃŲ

—\‚߁uƒƒ^•¶Žš‚ĘŒ¾‚Į‚Ä‚ą $ ‚µ‚©o‚Ä‚±‚Č‚¢v‚Ę‚©”»‚Į‚Ä‚é‚Č‚ē‘債‚½‚±‚Ę–³‚¢‚Æ‚Ē
ˆź”Ź‰»‚·‚ź‚Ī‚·‚é‚Ł‚Ē–Ź“|‚É‚Č‚é

726 F720F2013/02/07(–Ų) 22:14:56.21
>>725
‚ā‚Ķ‚č‚»‚¤‚Å‚·‚©B
”‚Ü‚Å‚±‚¤‚¢‚Į‚½ˆ—‚Ķsed‚Å‚µ‚±‚µ‚±ƒGƒXƒP[ƒv‚µ‚Ä‚ā‚Į‚Ä‚½‚ń‚Å‚·‚ŖA‚¢‚¢‰ĮŒø–Ź“|‚É‚Č‚Į‚½‚Ģ‚ŁA
‚½‚Ę‚¦‚Īfgrep‚Ż‚½‚¢‚ɐ³‹K•\Œ»‚šƒIƒt‚É‚µ‚ďˆ—‚·‚é•ū–@‚Ķ‚Č‚¢‚©‚Ę’T‚µ‚Ä‚¢‚é‚ń‚Å‚·‚ŖA
awk‚Å‚Ķ–³—‚Å‚·‚©EEEB

727 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/02/08(‹ą) 11:20:14.98
>>726
’P‚Ɉź’v‚Č‚ē³‹K•\Œ»‚Č‚ń‚©Žg‚ķ‚ø‚É”äŠr‚·‚ź‚Ī‚¢‚¢‚¶‚į‚ńB
fgrep‚ÅŽ–‚Ŗ‘«‚č‚é‚Ģ‚Č‚ēawk‚©‚ēfgrep‚š‹N“®‚·‚ź‚Ī‚¢‚¢‚¶‚į‚ńB

728 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/02/08(‹ą) 19:27:47.04
>>726
fgrep‚Č‚ē index()ŠÖ”‚¶‚į‚Č‚¢‚Ģ?

729 F720F2013/02/09(“y) 15:32:27.55
>>727
„’P‚Ɉź’v‚Č‚ē³‹K•\Œ»‚Č‚ń‚©Žg‚ķ‚ø‚É”äŠr‚·‚ź‚Ī‚¢‚¢‚¶‚į‚ńB
ˆÓ–”‚Ŗ•Ŗ‚©‚ē‚Č‚¢‚ń‚Å‚·‚ŖAawkć‚Ģ˜b‚Å‚·‚ę‚ĖH

>>728
index()‚Ģˆų”‚Ķ•¶Žš—ń‚¾‚©‚ēA‚±‚ź‚š‚¤‚Ü‚­Žg‚¦‚Ī–Ś“I‚Ģˆ—‚Ŗ‚Å‚«‚éEEE‚Ģ‚©‚ȁH

‚Å‚ą‚Č‚ń‚©awk‚Å‚²‚æ‚傲‚æ‚å‚ā‚é‚ę‚čAƒƒ^•¶Žš‚šƒGƒXƒP[ƒv‚·‚é‘Oˆ—‚š‚©‚Ü‚·‚Č‚č
‰½‚Ȃ肵‚½‚Ł‚¤‚Ŗ‘f’¼‚Č‹C‚Ŗ‚µ‚Ä‚«‚½EEEB‚½‚Ę‚¦‚Ī‚±‚ń‚ČŠ“‚¶‚Å

$ var='hoge$fuga'
$ var2=$( echo "$var" | sed 's/\$/\\\\$/g' )@©ƒGƒXƒP[ƒvˆ—
$ echo "$var" | awk -v var="$var2" '
$0 ~ var {print var}
END {print var}
'
hoge\$fuga
hoge\$fuga

730 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/02/09(“y) 17:49:52.25
/bin/sh‚Å‚²‚æ‚傲‚æ‚å‚ā‚é‚Ģ‚ŖD‚Ż‚Č‚ēAawk‚ąfgrep‚ąŽg‚ķ‚øAcase•¶‚Å‚ā‚č‚į‚¢‚¢‚ń‚¶‚į‚Č‚¢‚ĢB

731 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/02/09(“y) 21:34:09.39
>>729
•¶Žš—ń‚Ģ”äŠr‚Ķ“™†‚Å‚Å‚«‚é‚Į‚Ä”FŽÆ‚Ķ‚Č‚¢‚Ģ?

732 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/02/10(“ś) 14:31:49.57
>729
‚¢‚āA‚»‚Ģ•ū–@‚Å‚ąŒ‹‹Ē ' ‚ĶƒGƒXƒP[ƒv‚Ŗ•K—v‚Å‚µ‚åB
ƒ_ƒCƒŒƒNƒg‚ɃVƒFƒ‹•Ļ”‚É“ü‚ź‚é•ū–@‚©A
ƒtƒ@ƒCƒ‹‚Č‚Ē‚É“f‚«o‚µ‚Ä‚Ø‚­•ū–@‚Ģ•ū‚ŖˆĄ’čB
‚Ü‚Ÿ‚»‚ź‚Å‚ą‰üs‚Ę‚©§Œä•¶Žš“ü‚ź‚ē‚ź‚é‚Ę‚ą‚É‚å‚鏼‡‚Ŗ‚ ‚é‚Æ‚Ē‚ȁB

733 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/02/11(ŒŽ) 20:15:01.17
‚»‚±‚Ü‚Å‚ß‚ń‚Ē‚­‚³‚­‚Č‚Į‚½‚ēperl‚Ę‚©ruby‚Ę‚©Žg‚Į‚½•ū‚ŖŠy‚¾‚¼w

734 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/02/11(ŒŽ) 22:46:25.57
‰½‚Å gawk -f ‚Ę‚©Žg‚ķ‚øƒƒ“ƒ‰ƒCƒi[‚ɍS‚é‚Ģ‚©‚Ė‚„

735 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/02/12(‰Ī) 22:00:38.07
>>732
’†ŠŲƒtƒ@ƒCƒ‹‚šģ‚é‚Ģ‚ĶīŽć‚ĢŽdŽ–iƒhƒ„Šē
>>734
ƒƒ“ƒ‰ƒCƒi[ƒfƒBƒX‚Į‚Ä‚ń‚ĢH

736 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/03/11(ŒŽ) 10:05:12.56
#
# text converter ( Mac to MS-DOS on Windos/MS-DOS machine)
# convert CR to CR+LF
#
BEGIN{ RS = "\r" }
{ print }

737 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/03/15(‹ą) 08:05:25.28
#
# Line(s”)‚š”‚¦‚é
#

END { FNR }

738 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/03/20(…) 19:07:17.00
# text to html converter
# usage: awk -f txt2htm.awk infile1.txt > outfile2.html

BEGIN{
print("<html>"); print("<head>")
print("<titile> My favorite URLs </titile>")
print("</head>"); print("<h1> </h1>"); print("<body>");
}

/^[:space:]*http/ { print "<A HREF=\""$1"\">"$1"</A><BR>"}

END{
print("</body>")
print("</html>")
}

739 FUNIX(LF) to DOS(CR+LF) conversionF2013/03/21(–Ų) 21:15:00.86
awk 1 infile1 > outfile2.txt

740 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/03/21(–Ų) 22:10:08.07
# awk -f add.awk
BEGIN {
  s1 = "323524855"
  s2 = "4972560"

  reverse(a2, s2)
  size = reverse(a1, s1) # s1 > s2
  carry = 0

  for(k = 1; k <= size; k++) { # s1 > s2
    d = a1[k] + a2[k] + carry
    if(d >= 10) {
      e[k] = d - 10
      carry = 1
    } else {
      e[k] = d
      carry = 0
    }
  }

  if(carry == 1) {
    e[k] = 1
    size = k
  }

  g = produce_string(e, size)
  printf("%s + %s = %s\n", s1, s2, g)
  printf("%f\n", s1 + s2)
  exit
}

741 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/03/21(–Ų) 22:11:11.39
# >>740‚Ģ‚Ā‚Ć‚«
function reverse(a, s, k, i) {
  k = 1;
  size = length(s)
  for(i = size; i >= 1; i--) {
    a[k++] = substr(s, i, 1)
  }

  return size
}
function produce_string(a, size, i) {
  g = ""
  for(i = size; i >= 1; i--) {
    g = g a[i]
  }

  return g
}

742 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/03/21(–Ų) 22:12:57.08
function produce_string(a, size, g, i) {

743 Fgrep‚šawk‚ŁF2013/03/22(‹ą) 13:32:02.74
# usage: awk -f grep.awk char1 file1 file2

BEGIN{
pattern = ARGV[1]
ARGV[1] = ""
}
$0 ~ pattern {print($0" File name=" FILENAME)}

744 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/11/30(“y) 12:16:25.95
$ echo 10 20 30 | awk '{for(i=0;i<4;)print _$++i}'
10
20
30

_$++i‚Å‚ą$++i‚Å‚ą‚Ē‚æ‚ē‚Å‚ą‚¢‚Æ‚é‚Ģ‚Å‚·‚ŖAƒAƒ“ƒ_[ƒXƒRƒA‚Ŗ•t‚¢‚ĉ½ŒĢ‘åä•v‚Č‚Ģ‚Å‚µ‚傤‚©H

745 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/11/30(“y) 16:04:55.55
‚·‚¢‚Ü‚¹‚ńA‚ķ‚©‚č‚Ü‚µ‚½
‹ó‚Ģ•Ļ”_‚Ę$++i‚ĢŒ‹‰Ź‚Ŗˆź‚É‚Č‚Į‚Ä‚½‚¾‚Æ‚Č‚ń‚Å‚·‚Ė

746 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2013/11/30(“y) 20:37:58.81
’P‚ÉŽ®‚š•Ą‚ׂé‚Ę•¶Žš—ń˜AŒ‹‚É‚Č‚éA‚Ģć©‚©

747 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2014/04/02(…) 00:10:13.15 ID:T3/5Epfc
•ŪŽē

‚Ä‚©”¼”N‹ß‚­‘‚«ž‚Ż‚Ŗ–³‚©‚Į‚½‚©

748 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2014/04/14(ŒŽ) 22:41:42.89 ID:5r697USd
4.1.1‚Į‚Ä‚ą‚¤ƒŠƒŠ[ƒX‚³‚ź‚½‚ĢH

749 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2014/04/19(“y) 13:45:38.45 ID:Db2IzPol
‚Ę‚ ‚égawkƒXƒNƒŠƒvƒg‚Ģę“Ŗ‚Å
{last_hoge=hoge; hoge=$ 3}
‚Į‚Ä‚ā‚Į‚Ä‚é‚ń‚¾‚Æ‚ĒA
hoge=$ 3‚Ķhoge=$3‚ĢŠŌˆį‚¢? ‚»‚ź‚Ę‚ą‚±‚¤‚¢‚¤‹L–@‚Ŗ‚ ‚é?

750 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2014/04/19(“y) 14:56:08.53 ID:A73fEYrr
>>749
$ ‚Ķ‰‰ŽZŽq‚¾‚©‚ēAa=b+1‚ša = b + 1‚ʏ‘‚­‚ꂤ‚Č‚ą‚Ģ‚©‚ȁB

751 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2014/04/19(“y) 21:10:32.64 ID:Db2IzPol
‚¦‚¦[ ‰‰ŽZŽq‚¾‚Į‚½‚Ģ‚©‚ BÕŒ‚‚ĢŽ–ŽĄ

752 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2014/04/20(“ś) 12:36:45.70 ID:SQaIR8ej
‰‰ŽZŽq‚¾‚©‚ēA•Ļ”‚Å‚ą‚¢‚¢‚ęB

753 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2014/04/20(“ś) 14:34:12.09 ID:YSeiuWKu
Ž®‚Ŗ‘‚Æ‚é‚ĖB
$ ‚Ķˆź”Ō—Dę‡ˆŹ‚Ŗ‚‚¢‚©‚ēA‚©‚Į‚±‚ÅŠ‡‚ē‚É‚į‚¢‚©‚ń‚ŖB

754 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2014/04/20(“ś) 15:12:13.25 ID:k3tDznaJ
”‚Ķ‚¶‚ß‚Ä’m‚Į‚½Bhaskell‚Ģ$‚Ķ‰‰ŽZŽq‚¾‚Į‚Ä’m‚Į‚Ä‚½‚Æ‚ĒAawk‚Å‚ą‰‰ŽZŽq‚¾‚Į‚½‚ń‚¾‚ĖB

755 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2014/10/14(‰Ī) 13:37:28.35 ID:cBz5RbAX
‚»‚µ‚Ä”¼”N‹ß‚­‘‚«ž‚Ż‚Ŗ–³‚©‚Į‚½

756 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2014/10/15(…) 03:28:03.90 ID:SS4U/DMU
‚¢‚āawkƒXƒŒ‚Č‚ń‚Ä•’i‚Ķ‚»‚ń‚Č‚É˜b‘č‚Č‚¢‚¾‚ė

757 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2014/10/21(‰Ī) 15:46:10.36 ID:TQsAGJgk
Žæ–ā‚³‚¹‚Ä‚­‚¾‚³‚¢

”ƒfƒBƒŒƒNƒgƒŠ“ą‚Ģƒtƒ@ƒCƒ‹‚Ģ–¼Ģ‚ĘƒTƒCƒY‚ĢƒŠƒXƒg‚šģ‚č‚½‚¢‚ĘŽv‚Į‚Ä‚¢‚Ü‚·
ƒRƒ}ƒ“ƒh‚Ę‚µ‚Ä‚Ķls -l‚šŽĄs‚µ‚Ä‚¢‚Ü‚·‚Ŗ‚±‚ź‚š‚³‚ē‚Éawk‚ɃpƒCƒv‚µ‚Ä‚¢‚Ü‚·
‚½‚¾‚µƒtƒ@ƒCƒ‹–¼‚ɃXƒy[ƒX‚ŖŠÜ‚Ü‚ź‚Ä‚¢‚邽‚ßˆČ‰ŗ‚Ģ‚ꂤ‚Č‹ź“÷‚Ģō‚š‚Ę‚Į‚Ä‚Ø‚č‚Ü‚·‚Ŗ

ls -l | awk '{print $5 "\t" $9$10$11$12$13$14$15$16$17$18$19}'

10ŒĀˆČć‚Å‹ęŲ‚ē‚ź‚Ä‚é‰Ā”\«‚ą‚ ‚邽‚ߍŖ–{“I‚Č‘Ī‰ž‚š‚µ‚½‚¢‚ʍl‚¦‚Ä‚¢‚Ü‚·‚Ŗ
‚ę‚¢ˆÄ‚Ķ‚ ‚č‚Ü‚·‚Å‚µ‚傤‚©

758 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2014/10/21(‰Ī) 17:25:55.68 ID:EsuQiv22
# ƒtƒ@ƒCƒ‹–¼‚Ɂu"v‚ŖŠÜ‚Ü‚ź‚Ä‚¢‚½‚ē’m‚ē‚ĖB
ls -Ql |awk '{split($0, foo, "\x22"); print $5 "\t" foo[2]}'

759 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2014/10/21(‰Ī) 23:41:50.65 ID:stXOK2Vv
QƒIƒvƒVƒ‡ƒ“‚Ķ•×‹­‚É‚Č‚Į‚½
ls -l|awk '{s=$5;for(i=1;i<9;i++)$i="";print s"\t"$0}'

760 F–¼–³‚µ‚³‚ń—‚»‚¤‚¾‘I‹“‚ɍs‚±‚¤F2014/12/13(“y) 17:07:55.12 ID:8LbgKkKk
034@@‚Ķ@h@i”¼Špj
035@@‚Ķ@”@i”¼Špj@@@@@@@‚Å‚Ø‚‹‚Å‚·‚©H

761 F–¼–³‚µ‚³‚ń—‚»‚¤‚¾‘I‹“‚ɍs‚±‚¤F2014/12/13(“y) 18:17:16.35 ID:FQOeA8KF
>>760
‚¢‚¢‚¦ˆį‚¢‚Ü‚·B

762 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2014/12/14(“ś) 00:00:31.34 ID:7YfznIJB
‚Ē‚æ‚ē‚ą”ń‰Ā“Ē•¶Žš‚Å‚·‚ĖB‚»‚µ‚Ä‚»‚¤‚Č‚é‚ĘƒXƒŒˆį‚¢B
awk‚Ę—‚Ž‚Ģ‚Č‚ē‹ļ‘Ģ“I‚É‚Ē‚¤‚¼B

763 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2015/02/03(‰Ī) 10:36:52.13 ID:Dvc0nyMp
Terastation‚Ģƒtƒ@ƒCƒ‹Eƒzƒ‹ƒ_–¼‚ÉŽg‚¤‚Ęƒtƒ@ƒCƒ‹ƒŒƒvƒŠƒP[ƒVƒ‡ƒ“‚ŃGƒ‰[‚Ŗ‹N‚±‚镶Žš‚Ŗ‚ ‚Į‚āA‚»‚ź‚š•ĻŠ·‚·‚éƒoƒbƒ`‚š¶¬‚·‚鎞‚É‚±‚Ģƒ}ƒCƒi[Œ¾Œź‚Ŗ‘劈–ō‚µ‚½B
–ń80–œŒ‚Ģƒtƒ@ƒCƒ‹ƒzƒ‹ƒ_–¼‚©‚ē’Šo‚·‚é‚Ģ‚É10•Ŗ’ö“x‚¾‚Į‚½B

764 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2015/05/26(‰Ī) 00:18:03.33 ID:Y5HiR/XE
Gawk4.1.2‚Ŗo‚½‚Č‚ A‚ĘŽv‚Į‚Ä‚½‚ē‚·‚®4.1.3‚Ŗo‚½B
‘fl‚É‚Ķˆį‚¢‚Ŗ‚ ‚Ü‚č•Ŗ‚©‚ē‚ń‚Ģ‚¾‚ŖB

765 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2015/05/31(“ś) 09:20:55.82 ID:PB6Yeih1
http://www.amazon.co.jp/AWKŽĄ‘H“ü–å-Software-Design-plus-’†“‡/dp/477417369X

V‚µ‚¢–{Ao‚½‚ń‚¾‚Č
”p‚ź‚Č‚¢‚Ģ‚Ŗ¦‚¢

766 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2015/06/03(…) 20:45:34.22 ID:vBAc8MUN
>>765
”ƒ‚Į‚Ä‚«‚½B‚Ü‚¾Å‰‚Ģ•ū‚ĘÅŒć‚Ģ•ū‚š’­‚ß‚½‚¾‚Æ‚¾‚Æ‚ĒB

ƒy[ƒWiviu‚Ķ‚¶‚߂Ɂvj‚Åawk‚Ģ•\‹L‚É‚Ā‚¢‚āu–{‘“ą‚Å‚ĶA‚¢‚ø‚ź‚Ģ
ź‡‚ą‚·‚ׂﬕ¶Žš‚Ģawk‚Ę‚¢‚¤•\Œ»‚É“ˆź‚µ‚Ä‚Ø‚č‚Ü‚·v‚Ę
‚ ‚é‚Ģ‚ɁA‘–¼‚ŖAWKB

ŠŖ––‚ĢƒŠƒtƒ@ƒŒƒ“ƒX‚Å‹C‚É‚Č‚Į‚½‚Ę‚±‚ėB
‰‰ŽZŽq‚Ģ—Dę‡ˆŹ‚ɐG‚ź‚Ä‚¢‚Č‚¢AƒtƒB[ƒ‹ƒh‰‰ŽZŽq‚Ŗ
u“Į•Ź‚ČˆÓ–”‚šŽ‚Ā‚Č•Ļ”v‚Ģ’†‚É“ü‚ź‚ē‚ź‚Ä‚¢‚éB

ŽQl‘‚ā•¶Œ£‚Ŗ‚Č‚¢‚Æ‚ĒA”Žž‚Ķuƒlƒbƒg‚ŃOƒO‚źv‚©‚ȁB

767 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2015/07/06(ŒŽ) 22:02:56.12 ID:Wnwr3Nh9
Mono: Playback -9707 [5%] [-97.07dB] [on]
ć‚Ģs‚©‚ēƒp[ƒZƒ“ƒg‚šœ‚¢‚½”Žšić‚Ģ—į‚¾‚Ę5j‚šŽę“¾‚µ‚½‚¢‚Ģ‚Å‚·‚Ŗ‚Ē‚Ģ‚ꂤ‚É‚µ‚½‚ē‚ę‚¢‚Å‚µ‚傤‚©H
ƒp[ƒZƒ“ƒg‚Ģ’l‚Ķ0‚©‚ē100‚Ģ®”‚¾‚ĘŽv‚¢‚Ü‚·

768 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2015/07/07(‰Ī) 15:47:02.78 ID:NFKuqu84
# $0 ‚É“ü‚Į‚Ä‚¢‚é‚Ę‚µ‚Ä
sub(/%.*/, "");
sub(/.*[^0-9]/, "");

769 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2015/07/08(…) 11:55:27.32 ID:rptAPQZX
awk -F"[%[]" '{print $2}'
‚Å‚Ķ‚Ü‚ø‚¢?

770 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2015/07/08(…) 18:52:19.39 ID:GgkVcZ7j
>>768,769
‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚µ‚½
‚Ē‚æ‚ē‚Å‚ąŠó–]‚ĢŒ‹‰Ź‚š‹‚߂邱‚Ę‚Ŗ‚Å‚«‚Ü‚µ‚½

771 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2015/07/10(‹ą) 10:45:11.15 ID:VcZTZ3UB
ƒeƒ“ƒvƒŒ‚Å‚ ‚锤‚Ģ1‚Ŗ“Ē‚ß‚Č‚¢‚ń‚¾‚ŖA‚±‚ĢƒXƒŒ“I‚É‚ĶPOSIX‚ŏ‘‚­‚Ģ‚Ŗ
³“H•’i‚ĶGawk‚µ‚©Žg‚ķ‚Č‚¢‚Ģ‚ňź‰žŠm”FB

772 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2015/10/10(“y) 22:36:33.12 ID:1AEUTcmG
awk ‚Ģ a ‚ĶAaho ‚Ģ a

‚½‚¾‚µAƒGƒCƒz‚Ę“Ē‚Ž‚ē‚µ‚¢
‚Ö‚„[[[[[

773 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/02/12(‹ą) 17:12:05.45 ID:VH2jVHwT
awkŽg‚Į‚Ä‚éƒVƒFƒ‹ƒXƒNƒŠƒvƒgŒ©‚é‚Ę“¦‚°‚Ä‚é‚Č‚ ‚ĘŽv‚¤

774 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/02/18(–Ų) 00:13:16.92 ID:E3KgV2Kz
•’Ź‚Ķ x[3]=5 ‚ʏ‘‚­‚ŖA=‚Č‚µ‚Ģ
x[3]
‚¾‚Æ‚Å‚ąƒGƒ‰[‚Ę‚Č‚ē‚øAx ‚š”z—ń‚Ę‚µ‚ÄŠm•Ū‚µAlength(x)=1 ‚É‚Č‚é‚Ģ‚š”­Œ©
‚Ü‚ A‚ ‚Ü‚č•K—v‚Č‚¢‚Æ‚Ē

775 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/02/18(–Ų) 23:58:18.64 ID:kHIvdCfG
‚Ü‚ Agawk‚Ģƒ}ƒjƒ…ƒAƒ‹‚Å‚ą‘ć“ü‚Ģ‘O‚ÉŽQĘ‚Ŗo‚Ä‚­‚邵

776 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/02/20(“y) 00:57:58.12 ID:OTE8dQpJ
‚»‚¤‚Å‚µ‚½‚©AV”­Œ©‚Å‚Č‚©‚Į‚½

777 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/02/20(“y) 15:01:09.40 ID:91Q+YYwH
‘ć“ü‘O‚É‚¤‚Į‚©‚čŽQĘ‚µ‚Ä‚µ‚Ü‚¤‚Ģ‚Ķ‹H‚É—Ē‚­‚ ‚éB

778 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/02/28(“ś) 01:02:06.47 ID:Atbyv4Wk
IGNORECASE=1
‚šBEGIN ‚Ģ‘O‚É’u‚¢‚Ä‚ąƒGƒ‰[‚É‚Č‚ē‚øA•s‰Ā‰š“®ģ
ƒZƒLƒ…ƒŠƒeƒB“I‚É‚ā‚Ī‚­‚Č‚¢‚Ģ

779 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/02/28(“ś) 02:01:41.85 ID:2mMmSiU+
>>778
BEGIN ƒZƒNƒVƒ‡ƒ“‚šę“Ŗ‚ɏ‘‚Æ‚Ę‚Ķ‰½ˆ‚É‚ą‘‚¢‚Ä‚Č‚¢B

BEGIN ‚šÅŒć‚ɏ‘‚¢‚Ä‚ą END ‚šÅ‰‚ɏ‘‚¢‚Ä‚ą–ā‘č‚Ķ–³‚¢B
‰½ˆ‚ɏ‘‚¢‚Ä‚ąAŽĄŪ‚É‚Ķę“Ŗs“Ē‚Żž‚Ż‘OAŠes“Ē‚Żž‚ŻŽžAÅIs“Ē‚Żž‚ŻŒć‚É‚»‚ź‚¼‚ź
ƒpƒ^[ƒ“ƒ}ƒbƒ`‚Ŗs‚ķ‚ź‚Ä‚¢‚éB
‚½‚¾ƒ}ƒbƒ`‚·‚鏚Œ‚Ŗ“ĮŽź‚¾‚©‚ēAę“Ŗ‚©ÅŒć‚Å‚µ‚©’†‚Ģ•¶‚ŖŽĄs‚³‚ź‚Č‚¢‚¾‚ƁB

780 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/03/29(‰Ī) 09:03:58.15 ID:/c8bAcK4
ƒTƒbƒJ[ƒuƒbƒVƒ…“ś–{‘ć•\“ś’ö‚Õ‚ ‚½‚ńi‚µ‚ć‚Į‚æ‚傤‚Ü‚¢‚­‚ė‹³ˆē’·Œš‘ćjt•¶Ž·s40‘攄ć·ŠzƒVƒ…ƒK[ƒ`ƒ‡ƒR
https://www.youtube.com/watch?v=NDq1QoJY0nY‰Fƒhƒiƒ‹ƒhƒAƒiƒŠƒXƒgƒpƒ[ƒXƒg[ƒ“ƒR[ƒ`ƒ“ƒO‚Ę‚µ‚Ü‚¦‚ń
ƒTƒbƒJ[ƒuƒbƒVƒ…“ś–{‘ć•\“ś’öŒĆ–{‰®‚ꂵ‚½‚Æ‚µ‚ć‚Į‚æ‚傤‚æ‚傱‚µ‚ć‚Ŗ[
ƒfƒB[ƒ‰[Å–±“VĖŠJ”­ŽŅŽ€–S‹l‚Żƒˆƒ~ƒhƒNƒ^[ƒ}ƒCƒNƒƒT[ƒrƒX•s‘«
ƒTƒbƒJ[ƒuƒbƒVƒ…“ś–{‘ć•\“ś’ö‚Õ‚ ‚½‚ńƒVƒtƒgŒõ‹ą‚³‚©‚¢‹­§ƒoƒCƒglŒ NŠQ–ā‘č
t•ŖŽ‘Œ¹Ž·sƒjƒ…[ƒˆ[ƒN’įŒ“‰æ‚Ś‚Į‚½ƒXƒe[ƒLƒ\ƒ‹ƒgƒŒƒCƒN•Ÿ‰Ŗ‰”•lV‹““z—ź‰Ū‹ąƒpƒ`ƒVƒtƒg‹­§ƒoƒCƒg–ā‘čVŠƒ•ÄƒZƒ“ƒ^[¶Žc
ƒRƒXƒ‚Q‚Sƒ`ƒƒƒŠƒeƒB[‰B‚ź40‘搶Šˆ•ŪŒģƒvƒŒƒCƒ{[ƒCƒoƒCƒgƒŒ[ƒh‚¢‚½‚č‚ ‚ńŚ‘Ņ–ā‘č
ƒ}ƒXƒRƒ~KARDƒ[ƒ“ƒP[ƒI[ƒT[ƒrƒX•s‘«„Šˆƒp[ƒeƒB[Šń•t‹ąŽ·sŒ“”­ƒrƒWƒlƒX
FBIƒ`ƒƒƒCƒj[ƒYƒ^ƒCƒzƒeƒ‹”„ćŽ––±ŠƒKƒ`ƒƒŒˆŽZƒKƒ`ƒƒƒLƒƒƒ“ƒy[ƒ“i”Ģ”„•ń“¹w‰ßŒƒ”h‘gDŒüŒg‘ŃÅVī•ń’ń‹ŸI—¹
Z’·”­Œ¾×S’ˆÓƒm[ƒgƒ“ŽY”pƒGƒ‰[(’˜ģŒ ƒNƒŒ[ƒ€’†‘”½‰ž—ZŽ‘‚Šz‹³ˆē”ļ)(’†‘•ßŒ~’c‘Ģ40‘掊ˆõƒTƒbƒJ[ƒRƒƒ“ƒg
‚Šz“üŠw‹ąƒ„ƒtƒEV‹“‘åŠwƒ„ƒtƒEV‹“—Ž–’·FXŒo”ļ ‚Ø‚¶‚ā50‘掑ŽYƒKƒŠƒoƒYƒtƒB[ƒh40‘ćƒGƒŠ[ƒg

781 Fawk–½F2016/05/10(‰Ī) 10:11:56.15 ID:qP72K9YB
mawk32.exe‚Łumultibyte charv‚ĢƒƒbƒZ[ƒW‚Ŗ‚łč¢‚Į‚Ä‚Ü‚·A‰½‚ŖŒ“ˆö‚Å‚µ‚傤?
—}Ž~‚·‚é•ū–@‚Ķ‚ ‚č‚Ü‚·‚©?
multibyteŽw’č‚ĢƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ƒIƒvƒVƒ‡ƒ“‚Ķ–³‚¢‚ꂤ‚Č‚Ģ‚Å‚·‚Ŗ?

782 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/05/10(‰Ī) 13:22:33.71 ID:pT7b4QGj
UTF-8 ‚ŖŽg‚¦‚Č‚¢‚Ģ‚©‚ą

umawk multibyte charv‚ÅŒŸõI

783 Fawk–½F2016/05/11(…) 00:10:08.64 ID:EkexSAUH
„‚V‚W‚Q

ƒf[ƒ^‚ąƒvƒƒOƒ‰ƒ€‚ą‚r‚i‚h‚r‚Å‚·B
‰½‚É”½‰ž‚µ‚Ä multibyte char‚Ŗo‘±‚Æ‚é‚Ģ‚©•s–¾‚Å‚·B
‚‡‚‚—‚‹‚‘¬‚Č‚Ģ‚Å–ž‘«‚Č‚Ģ‚Å‚·‚ŖA‚r‚s‚c‚d‚q‚q‚É multibyte char‚Ŗ‚Å‘±‚Æ‚é‚Ģ‚Å‚¤‚“‚¢‚µA‚±‚Ģo—Ķ‚Ō‚ń‚¾‚Æ‘¬“x‚ą’į‰ŗH

784 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/05/11(…) 00:13:30.76 ID:Qn6YFszJ
“ü—Ķ‚ÉSJIS‚Å‚Č‚¢•¶Žš‚Ŗ¬Ż‚µ‚Ä‚¢‚邱‚Ę‚Č‚¢H
nkf -s “ü—Ķƒtƒ@ƒCƒ‹ | awk
‚Å•ĻŠ·‚µ‚½‚ē

785 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/05/11(…) 03:47:08.47 ID:6KznZIvs
ƒR[ƒh‚š‹³‚¦‚ĉŗ‚³‚¢B
ƒ`ƒƒƒŒƒ“ƒW‚µ‚Ü‚µ‚½‚ŖA‚±‚ź‚Å‚Ķƒ_ƒ‚Å‚·BB
(for i=1, i<=NF, i++){
if $i<0{$i=0}
}
print $0


‚µ‚½‚¢‚±‚Ę‚ĶA‰ŗ‹L‚Ģ‚ꂤ‚ȍs—ń‚Ģ”Žš‚Ŗ‚ ‚Į‚āA•‰‚Ģ’l‚šƒ[ƒ‚É’uŠ·‚µ‚½‚¢‚Å‚·B

„Œ³‚Ģs—ń
3 15 6 1
-5 4 0 2
8 9 -7 11

„‚ā‚č‚½‚¢•ĻŠ·Œć‚Ģs—ńƒCƒ[ƒW
3 15 6 1
0 4 0 2
8 9 0 11

786 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/05/11(…) 04:14:37.49 ID:gi9ycYMA
\•¶‚Ŗ‚ŗ‚ń‚ŗ‚ń‘Ź–ŚB
{for(i=1;i<=NF;i++)if($i<0){$i=0};print $0;}

u‚µ‚½‚¢‚±‚Ę‚ĶA`‚µ‚½‚¢‚Å‚·Bv‚Ģ\•¶‚ą‘Ź–ŚB“TŒ^“I‚Č‚Ė‚¶‚ź•¶B

787 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/05/11(…) 07:39:07.59 ID:E3fj3Ww+
Ruby, Python ‚Č‚Ē‚šŽg‚¦‚ĪH

788 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/05/11(…) 12:31:52.37 ID:ZhRn3EDd
>>787
Ruby, Python ƒXƒNƒŠƒvƒg‚š’ńŽ¦‚µ‚Ä‚Ż‚ė‚ęB

789 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/05/11(…) 22:58:11.78 ID:Lckmn9CP
>>786
‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·Io—ˆ‚Ü‚µ‚½I

(ˆźsƒvƒƒOƒ‰ƒ~ƒ“ƒOIawk•Ö—˜‚Å‚·‚Ė)

790 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/05/13(‹ą) 01:56:22.83 ID:VtzDMLxe
awk ‚¶‚į‚Č‚­‚Ä‚ą‚¢‚¢‚ń‚Č‚ē

$ sed 's/-[0-9][0-9]*/0/g' ...

GNU sed ‚Č‚ē

$ sed -r 's/-[0-9]+/0/g' ...

‚Å‚¦‚¦‚ń‚æ‚į‚¤H

791 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/06/22(…) 00:21:13.08 ID:X+fwM1CQ
‚©‚܂Ձ@uwƒVƒFƒ‹Œ|x‚ÉŒų‚­ AWKˆ•ūā³v

ƒGƒCƒzę¶uAWK‚Į‚ÄŽg‚¢ŽĢ‚Ä‚ĢŒ¾Œźi’†—Ŗjƒvƒ‰ƒXƒAƒ‹ƒtƒ@‚Ģˆ—‚Ŗ‚ā‚č‚½‚¢‚ę‚ĖB
‚½‚¾‚»‚Ģˆ—‚Ķ‚Ę‚Ä‚ąŠČ’P‚ȏˆ—‚Å‚¢‚¢B‚»‚±‚É‘Ī‚µ‚ĐV‚µ‚¢ƒvƒƒOƒ‰ƒ€Œ¾Œź‚šģ‚Į‚Ä‚¢‚«‚½‚¢v

AWKƒu[ƒ€‘ę1¢‘ć‚ĶuƒAƒCƒhƒ‹Ž«‘v‚ÅŠw‚ń‚¾\\“ś–{GNU AWKƒ†[ƒU[‰ļ Ä“”‚³‚ń (1/5)FCodeZineiƒR[ƒhƒWƒ“j
http://codezine.jp/article/detail/9478
2016/06/15 14:00

792 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/06/22(…) 23:46:54.12 ID:P+7nG182
‚ā‚½‚ē‚Ę‘±‚«‚Ķ“o˜^‚µ‚Ä“Ē‚ß‚ĘŒ¾‚ķ‚ź‚Ä‚ą‚Č‚ B
‚±‚ĢƒXƒŒ‚Ŗ—§‚Į‚½ ‚©‚ēJGAUC‚ĢHP‚ŖXV‚³‚ź‚Ä‚¢‚Č‚¢‚Į‚Ä‚Ģ‚ą¦‚¢B

793 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/08/27(“y) 09:20:46.26 ID:2q8s4uQl
Windows”Å‚Ģgawk‚Å—V‚ń‚Å‚½‚ē
for (i=0; i<n; i++) ‚ę‚č
for (i=0; i<n; i+=1) ‚Ģ‚Ł‚¤‚Ŗ
ŽĄsŽžŠŌ‚Ŗ’Z‚­‚Ȃ邱‚Ę‚É‹C‚Ć‚¢‚½
‚Č‚ń‚¾‚±‚č‚į

794 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/13(‰Ī) 23:56:36.77 ID:mfLTwPLq
for(i=1;i<=1000000;i++){a[i]=1}
‚Ę
for(i=1;i<=1000000;i++){a[i]=sprintf("1")}
Œ‹‰Ź‚Ķ“Æ‚¶‚Ķ‚ø‚Č‚Ģ‚ɁAŒćŽŅ‚ĶˆŁķ‚Ƀƒ‚ƒŠ‚šH‚¤I‚Ó‚µ‚¬I

795 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/14(…) 00:22:19.58 ID:YCeX8Gov
“Æ‚¶‚¶‚į‚Č‚¢‚¼B”’l‚Ę•¶Žš—ń‚¾B
‚Ę‚±‚ė‚ŁAŒN‚ŖŽg‚Į‚Ä‚é awk ‚Ķ‚Ē‚ź?

apropos awk

‚Į‚Ä‚ā‚Į‚Ä‚Ż‚½‚ēA‚±‚ń‚Č‚ńo‚Ä‚«‚½B

gawk (1) - ƒpƒ^[ƒ“ŒŸõEˆ—Œ¾Œź
igawk (1) - ƒCƒ“ƒNƒ‹[ƒhƒtƒ@ƒCƒ‹‚šŽg‚¤ gawk
a2p (1) - Awk to Perl translator
awk (1) - pattern scanning and text processing language
English (3perl) - use nice English (or awk) names for ugly punctuation v...
mawk (1) - pattern scanning and text processing language
nawk (1) - pattern scanning and text processing language

796 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/14(…) 22:01:59.31 ID:DqYC5LBT
>>795
—į‚Ŗˆ«‚­‚ăXƒ}ƒ\ACygwinć‚Ågawk4.1.4Žg‚Į‚Ä
for(i=1;i<=1000000;i++){a[i]="1"}
‚Ę
for(i=1;i<=1000000;i++){a[i]=sprintf("1")}
‚Ń‹[ƒv’Eo’¼Œć‚Ģƒƒ‚ƒŠŽg—p—Ź‚š”äŠr‚·‚é‚Ę
ć‚Ŗ60MBytesA‰ŗ‚Ŗ600MBytes‚Ę‚©‚É‚Č‚Į‚½

cmd‚Å“®‚­gawk‚Ģ3.1.7‚Å‚ą“Æ‚¶‚ꂤ‚ȍ·‚Ŗ‚Å‚½
Linux‚ĶŽŽ‚µ‚Ä‚¢‚Č‚¢‚Æ‚ĒA‚ą‚µ‘åä•v‚Č‚ēWindows”Å‚Ģ–ā‘č‚©‚ą

797 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/14(…) 22:50:10.30 ID:PWB0Awgu
>>796
OSX El Capitan
gawk 4.1.4

‚»‚ź‚¼‚źBEGIN{}‚É“ü‚ź‚½ƒXƒNƒŠƒvƒg‚š“Ē‚Żž‚Ü‚¹‚ÄŽĄsB
‚Å‘OŽŅ”\MBAŒćŽŅ3GB’“‚܂сƒ‚ƒŠŽg‚Į‚½iƒAƒNƒeƒBƒrƒeƒBƒ‚ƒjƒ^jB

798 F795F2016/09/14(…) 23:40:38.22 ID:YCeX8Gov
‚ā‚Į‚Ä‚Ż‚½‚ęBŠĀ‹«‚Ķ Debian jessieB
ƒeƒXƒgƒvƒƒOƒ‰ƒ€

#!/usr/bin/perl -w
use strict;
{
my $do_ps = 'system("ps p $PPID o pid,sz,args")';
foreach ( 1,'sprintf("1")'){
system('gawk',"BEGIN { for(i=1;i<=1000000;i++){a[i]=$_} $do_ps;}");
}
}

ŽĄsŒ‹‰Ź

PID SZ COMMAND
7389 7693 gawk BEGIN { for(i=1;i<=1000000;i++){a[i]=1} system("ps p $PPID o pid,sz,args");}
PID SZ COMMAND
7392 158116 gawk BEGIN { for(i=1;i<=1000000;i++){a[i]=sprintf("1")} system("ps p $PPID o pid,sz,args");}

KB ’PˆŹ‚ē‚µ‚¢‚©‚ē 8MB ‚Ę 160MB B‚½‚¾‚²‚Ę‚¶‚į‚Č‚¢·‚¾‚ĖB
1 ‚š "1" ‚É•ĻX‚µ‚Ä‚ą‚±‚ń‚ČŠ“‚¶‚¾‚©‚ē”’l‚Ę•¶Žš—ń‚Ģ·‚Ę‚¢‚¤‚ķ‚Æ‚Å‚Ķ‚Č‚³‚»‚¤B

799 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/14(…) 23:49:14.48 ID:YCeX8Gov
‚²‚ß‚ńA‘‚«–Y‚ź‚½B

GNU Awk 4.1.1, API: 1.1 (GNU MPFR 3.1.2-p3, GNU MP 6.0.0)
Copyright (C) 1989, 1991-2014 Free Software Foundation.

800 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/17(“y) 08:30:37.61 ID:didBD5ba
‚ę‚­l‚¦‚½‚ēAƒƒ‚ƒŠ‚ĢŽg—p—ŹŽ©‘Ģ‚¶‚į‚Č‚­‚āA‚»‚ź‚Ŗ‚Ē‚ź‚¾‚Æ‘‚¦‚½‚©‚Ŗd—v‚¾‚ĖB
‚»‚µ‚āA˜A‘z”z—ń‚Ģ\‘¢‘Ģ‚ĘƒL[‚É•K—v‚Č—Ź‚Ķ‚Ē‚ĢƒP[ƒX‚Å‚ą“Æ‚¶‚ʍl‚¦‚ē‚ź‚éB
‚Ā‚Ü‚čA˜A‘z”z—ń‚Ģ—v‘f‚Ģ‚½‚ß‚Ģ—Ź‚Ŗ‚Ē‚ź‚¾‚ƈį‚¤‚©‚š’¼Ś’m‚邱‚Ę‚Ŗ‚Å‚«‚é‚Ķ‚øB
‚Ę‚¢‚¤‚ķ‚ƂŁA‚ą‚¤ˆź‰ńƒeƒXƒgB

https://ideone.com/mRuFj7

801 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/17(“y) 08:32:42.20 ID:didBD5ba
ŽĄsŒ‹‰Ź

element before after diff
1 5685 7691 2006
i 5685 29226 23541
sprintf("%d",i) 5685 158124 152439
sprintf("%d",i) + 0 5685 29221 23536
sprintf("%d",i) "" 5685 37026 31341

1000000 —v‘f‚Ģ”z—ń‚Å 2MB ‚Į‚āA‚¢‚Į‚½‚¢‚Ē‚¤‚ā‚Į‚Ä‚é‚ń‚¾‚ė‚¤B­‚Č‚·‚¬‚éB
sprintf("%d",i) ‚Ŗ“Ėo‚µ‚Ä‘½‚¢‚Ģ‚Ķ sprintf ‚Å‘½‚ß‚ÉŠm•Ū‚µ‚Ä
Ų‚č‹l‚ß‚½‚č‚¹‚ø‚É‚»‚Ģ‚Ü‚ÜŽg‚Į‚Ä‚é‚Ģ‚¾‚ė‚¤‚©B
‚³‚ Agawk ‚Ģƒ\[ƒXƒR[ƒh‚šƒnƒbƒN‚µ‚Ä‚Ż‚é‚©!

802 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/17(“y) 14:11:27.89 ID:IIH0ZjSk
„‘Ŗ‚¾‚Æ‚ĒAstream, yield, callbackA’x‰„ˆ—‚©‚ą

ƒf[ƒ^‚šƒoƒbƒtƒ@ƒTƒCƒY•Ŗ‚¾‚Æ“Ē‚Żž‚ń‚ŏˆ—‚µ‚āA
ŽŸ‚ĢƒRƒ}ƒ“ƒh‚Ö‘—‚Į‚½‚ēA‚»‚ź‚šŽĢ‚ĂāAŽŸ‚Ģƒf[ƒ^‚š“Ē‚Żž‚Ž‚Ģ‚©‚ą

‚±‚Ģ•ūŽ®‚¾‚Ęƒƒ‚ƒŠ‚ĶAƒoƒbƒtƒ@ƒTƒCƒY•Ŗ‚¾‚Æ‚µ‚©Žg‚ķ‚Č‚¢

803 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/18(“ś) 10:41:36.96 ID:6jI6cHER
ƒxƒNƒ^[‚ÉŒöŠJ‚³‚ź‚Ä‚égawk3.1.5i‚Ę”ńŒöŠJ‚Ģ3.1.7jAƒwƒ“ƒeƒR‚ȏˆ—‚ŖŒ©‚Ā‚©‚Į‚½‚Ģ‚сƒ‚
‚±‚Ģgawk‚ĢsystemŠÖ”‚šŽĄs‚·‚é‚ʁAŠĀ‹«•Ļ”TMP‚ŖŽw‚µ‚Ä‚éƒtƒHƒ‹ƒ_‚É
@echo off
systemŠÖ”‚Ģˆų”
‚Ę‚¢‚¤2s‚Ŗ‘‚©‚ź‚½ƒoƒbƒ`ƒtƒ@ƒCƒ‹pip?.bati?‚ĶsystemŽĄs‰ń”+1j‚Ę‚¢‚¤‚Ģ‚Ŗģ¬‚³‚ź

804 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/18(“ś) 10:44:42.56 ID:6jI6cHER
EEE‚¢‚Į‚Ų‚ń‚ɏ‘‚±‚¤‚Ę‚µ‚½‚ēƒnƒl‚ē‚ź‚éorz

805 F803F2016/09/18(“ś) 10:46:32.08 ID:6jI6cHER
(‘±‚«)
‚»‚ź‚š/c pip?.bat‚Å‹N“®AŠ®—¹Œć‚Épip?.bat‚š
ķœ‚Ę‚¢‚¤—¬‚ź‚ŃRƒ}ƒ“ƒh‚ŖŽĄs‚³‚ź‚é

806 F803F2016/09/18(“ś) 10:47:07.98 ID:6jI6cHER
(‘±‚«)
systemŠÖ”‚šŽg‚Į‚½ƒXƒNƒŠƒvƒg‚š“ÆŽž‚É1‚Ā‚µ‚©ŽĄs‚µ‚Č‚¢‚Č‚ē—Ē‚¢‚Æ‚Ē
2‚ĀˆČćŽĄs‚µ‚½‚Ę‚«‚Ķƒ^ƒCƒ~ƒ“ƒOŽŸ‘ę‚Åpip?.bat‚Ģ”Žš‚Ŗ‚Ō‚Ā‚©‚čAę‚ÉŽĄs‚µ‚½‘¤‚Ŗ
E ƒRƒ}ƒ“ƒh‚ŖŽĄs‚³‚ź‚Č‚¢
E ƒRƒ}ƒ“ƒh‚ŖŽĄs‚³‚ź‚é‚Æ‚ĒAŠ®—¹Œć‚Ɂuƒoƒbƒ`ƒtƒ@ƒCƒ‹‚ŖŒ©‚Ā‚©‚č‚Ü‚¹‚ńv‚Ŗ“f‚©‚ź‚é
‚Ę‚¢‚¤Œ‹‰Ź‚É‚Č‚é

—\‚ßcmd‚Ģ‘‹‚²‚Ę‚ÉTMP‚š•Ļ‚¦‚Ä‚Ø‚Æ‚Ī–ā‘č‚Č‚¢‚Æ‚Ē–Ź“|‚­‚³‚¢
ƒRƒ}ƒ“ƒh | getline‚Å‹N“®‚µ‚½‚Ł‚¤‚ŖŽč‚ĮŽę‚葁‚¢‚ĘŽv‚¤
i‚½‚¾‚µo—Ķ‚Ŗ2KBytes—­‚Ü‚é‚ĘŽ~‚Ü‚é‚©‚ē“K‹XƒŠƒ_ƒCƒŒƒNƒg‚·‚éj

‚Å‚ą‰½‚Å‚±‚ń‚Č•ū–@‚ÅsystemŠÖ”‚šŽĄ‘•‚µ‚½‚ń‚¾‚ė‚¤‚Ė(LEƒÖEM)

807 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/18(“ś) 13:53:41.51 ID:EIh/dcA1
tmpfile ‚šŽg‚¦‚ĪA‘¼‚ʏd•”‚µ‚Č‚¢Aƒ‰ƒ“ƒ_ƒ€‚Č–¼‘O‚Ģƒtƒ@ƒCƒ‹‚šģ‚ź‚é‚Ģ‚ɁA

‚Ē‚¤‚µ‚ÄŽg‚ķ‚Č‚¢‚Ģ‚¾‚ė‚¤H

808 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/18(“ś) 14:54:02.97 ID:KtcAr9oX
MS-DOS ‚Å‚Ķ‚ĖAƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚Ģ’·‚³‚Ģ§ŒĄ‚ŖŒµ‚µ‚©‚Į‚½‚ń‚¾‚ęB‹Į‚­‚Č‚©‚źA‚½‚Į‚½ 128 ƒoƒCƒg‚¾B
‚»‚ń‚ČŠĀ‹«‚Å‚ĶAƒoƒbƒ`ƒtƒ@ƒCƒ‹‚É‚·‚ź‚ĪŽĄs‚Å‚«‚é‚Æ‚Ē

command /c "prog arg1 arg2 ..."

‚Å‚Ķ command /c ‚Ģ‚¹‚¢‚Ő§ŒĄ‚š‰z‚¦‚é‚Ę‚¢‚¤‚±‚Ę‚ą‚ ‚邾‚ė‚¤B‚Ā‚Ü‚čA‚»‚¤‚¢‚¤‚±‚Ę‚¾B
cccē’k‚¾BŠm‚©‚É‚»‚¤‚¢‚¤§ŒĄ‚Ķ‚ ‚Į‚½‚Æ‚ĒB
Œ»Ż‚Ķ‚ą‚¤ system ŠÖ”‚Å‚Ķ‚»‚¤‚¢‚¤‚±‚Ę‚š‚µ‚Ä‚¢‚Č‚¢‚Ę‚¢‚¤‚±‚Ę‚Ŗ ChangeLog ‚ɏ‘‚©‚ź‚Ä‚é‚ęB

2014-01-15 Eli Zaretskii <eliz@gnu.org>
* popen.c (os_system): Use spawnl, and quote the command line, to be consistent with what gawk_popen does.
(os_popen) [__MINGW32__]: Don't scriptify the command, to be consistent with gawk_popen.
(os_pclose) [__MINGW32__]: Update to match os_open: no need to unlink the script file.

809 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/18(“ś) 15:07:54.47 ID:KtcAr9oX
‚Å‚ąƒ\[ƒXƒR[ƒh‚šŒ©‚é‚©‚¬‚čAƒpƒCƒv‚Å‚Ķ‚»‚¤‚¢‚¤‚±‚Ę‚š‚µ‚Ä‚é‚Ż‚½‚¢‚Č‚ń‚¾‚Æ‚Ēcc
‚æ‚å‚Į‚ĘŽŽ‚µ‚Ä‚Ż‚Ä‚­‚ź‚Č‚¢‚©‚ȁB

system("dir") | getline

‚Ż‚½‚¢‚ČŠ“‚¶? ‚ę‚­’m‚ē‚Č‚¢‚Æ‚ĒB

810 F803F2016/09/18(“ś) 16:19:12.82 ID:6jI6cHER
ƒRƒ}ƒ“ƒh | getline ‚Å‹N“®‚·‚鏼‡‚Ķpip?.bat‚Ķģ‚ē‚ź‚Ü‚¹‚ń‚Å‚µ‚½
systemŠÖ”‚¾‚Æpip?.batŒo—R‚Ģ–Ķ—l
klabaster”Å‚Ģwindows—pgawk4.1.3‚¾‚ĘsystemŠÖ”‚Ŗpip?.bat‚š
ģ‚ē‚Č‚©‚Į‚½‚©‚ēAƒxƒNƒ^[”ŌŗL‚Ģ“®‚«‚©‚Č‚ ‚ĘŽv‚¢‚Ü‚·

811 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/18(“ś) 17:46:00.36 ID:KtcAr9oX
‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B
gawk-4.1.1 ‚Ģ pc/popen.c ‚šŒ©‚½ŒĄ‚č‚Å‚Ķ gawk ‚Ģ system ŠÖ”‚Ńoƒbƒ`ƒtƒ@ƒCƒ‹‚šģ‚é‚Ģ‚Ķ MINGW ŒĄ’č‚ŁA
ChangeLog ‚É‚Ķ–ā‘č‚Ŗ‰šĮ‚³‚ź‚½‚©‚ē’¼Ś spawnl ‚ÅŽĄs‚·‚é‚ꂤ‚É‚µ‚½‚ʏ‘‚©‚ź‚Ä‚¢‚é‚ķ‚Æ‚Å‚·‚Ŗ
gawk ‚ĢƒpƒCƒvˆ—‚šŽĄs‚µ‚Ä‚¢‚é(‚ĘŽv‚ķ‚ź‚é) os_popen ŠÖ”‚Å‚Ķƒoƒbƒ`ƒtƒ@ƒCƒ‹‚šģ‚é‚Ę‚«‚Ę“Æ—l‚É
tempnam ŠÖ”‚Ńtƒ@ƒCƒ‹–¼‚šģ‚Į‚½ć‚ŁA‚»‚Ģƒtƒ@ƒCƒ‹‚šŒo—R‚µ‚ÄŽó‚Æ“n‚µ‚š‚µ‚Ä‚¢‚é‚ꂤ‚ÉŒ©‚¦‚Ü‚·B
‚±‚ź‚Ķ MS-DOS ‚ĢŽž‘ć‚©‚ēŽg‚ķ‚ź‚Ä‚é‚ā‚č•ū‚ŁAƒpƒCƒv‚Ģ‚ꂤ‚ÉŒ©‚¦‚Ä‚ąƒpƒCƒv‚Å‚Ķ‚ ‚č‚Ü‚¹‚ńB
‚±‚Ģ‚ā‚č•ū‚¾‚Ę gawk ‚Å

while (( command | getline) > 0)

‚ʏ‘‚¢‚Ä‚ąŽĄŽæ“I‚É‚Ķ

system("command > filename"); while (( getline < "filename") > 0)

‚Ę“Æ‚¶‚±‚Ę‚É‚Č‚č‚Ü‚·B
‚ ‚­‚Ü‚Å‚ą 4.1.1 ‚Ģ pc/popen.c ‚Ģ os_popen ŠÖ”‚Ŗ‚»‚¤Œ©‚¦‚é‚Ę‚¢‚¤‚¾‚ƂŁAŽĄŪ‚É‚Ķˆį‚¤‚©‚ą‚µ‚ź‚Ü‚¹‚ń‚Ŗ
Ž©•Ŗ‚ÅŽŽ‚·‚±‚Ę‚Ŗ‚Å‚«‚Ü‚¹‚ńB‚»‚ą‚»‚ą 3.1.5 ‚Ģƒ\[ƒXƒR[ƒh‚Į‚Ä‚Ē‚±‚É‚ ‚é‚Ģ?
‚ą‚µŠØˆį‚¢‚¶‚į‚Č‚¢‚Č‚ē >>806 ‚Ę“Æ‚¶–ā‘č‚Ŗ‹N‚±‚č‚»‚¤‚Č‹C‚Ŗcc
Linux ‚šŽg‚Į‚Ă鎩•Ŗ‚É‚ĶŠÖŒW‚Č‚¢‚Ę‚¢‚Į‚Ä‚µ‚Ü‚¦‚Ī‚»‚ź‚Ü‚Å‚Å‚·‚ŖB

812 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/18(“ś) 19:56:17.75 ID:zTPoEkjL
>>811
vector‚Ģ”z•zƒtƒ@ƒCƒ‹“ą‚Ģreadme‚É‚Ķƒ\[ƒXƒR[ƒh‚Ģ
ŒöŠJźŠ‚š’T‚µ‚Ä‚é‚Ę‚©A’¼Ś˜A—‚·‚ź‚Ī“n‚·‚Ę‚©‘‚¢‚Ä‚ ‚éB

Windows”ŁANT‚ ‚½‚č‚©‚ēˆźŽžƒtƒ@ƒCƒ‹ģ‚ē‚ø‚ɃpƒCƒv“®ģ‚·‚é‚ꂤ‚É
‚Č‚Į‚½‚Ę‚©A‚Ē‚±‚©‚Å“Ē‚ń‚¾‹C‚Ŗ‚·‚é‚Æ‚ĒB

813 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/18(“ś) 22:03:20.37 ID:KtcAr9oX
“ä‚Ķ‰š‚Æ‚½B
ƒtƒ@ƒCƒ‹‚šŽg‚Į‚ăf[ƒ^‚š“n‚·‚Ģ‚Ķƒ}ƒNƒ __DJGPP__ ‚Ęƒ}ƒNƒ __MINGW32__ ‚Ŗ
‚¢‚ø‚ź‚ą’č‹`‚³‚ź‚Ä‚¢‚Č‚¢ź‡‚ē‚µ‚¢‚Å‚·B
Vector ‚Ģ‚Ķ MINGW ‚Č‚Ģ‚ÅŠY“–‚µ‚Ü‚¹‚ńB‚Ø‘›‚Ŗ‚¹‚µ‚Ü‚µ‚½B

814 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/19(ŒŽ) 11:56:06.00 ID:iIvzjj/t
ƒtƒ@ƒCƒ‹‚šŒo—R‚µ‚Ä‚¢‚Ä‚ąAƒXƒgƒŒ[ƒW‚ɏ‘‚«ž‚Ž‚Ę‚ĶŒĄ‚ē‚Č‚¢

ƒƒ‚ƒŠć‚¾‚Æ‚É‘¶Ż‚·‚éAƒtƒ@ƒCƒ‹‚ą‚ ‚č“¾‚éB
Linux‚ĢRAMƒfƒBƒXƒNAtmpfs ‚Ę‚©

815 F803F2016/09/19(ŒŽ) 14:26:19.66 ID:fDWhtT6v
>>811
ī•ń‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·B>>803‚ŏ‘‚¢‚½uƒwƒ“ƒeƒR‚ȏˆ—v‚špc\popen.c“ą‚ÉŠm”F‚Å‚«‚Ü‚µ‚½B
scriptifyŠÖ”‚ĢtempnamŒÄ‚ń‚Å‚é‚Ę‚±‚ė‚ŃvƒƒZƒXID‚ą‚Ā‚Æ‚é‚Č‚čA×H‚µ‚½‚¢‚Č‚ EEE

816 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/20(‰Ī) 17:00:26.41 ID:RIxgZ1yj
ę“śƒAƒNƒZƒX‚Å‚«‚Č‚©‚Į‚½ GNU ‚ĢƒTƒCƒg‚Ŗ•œŠˆ‚µ‚Ä‚½‚Ģ‚Å 3.1.5 ‚Ģƒ\[ƒXƒR[ƒh‚š“üŽč‚Å‚«‚Ü‚µ‚½B
‚ā‚Į‚Ļ‚č os_popen ‚©‚ē‚ą scriptify ‚šŒÄ‚ń‚Å‚½‚Ż‚½‚¢‚Å‚·‚ĖB4.1.1 ‚Ģƒ\[ƒXƒR[ƒh‚¶‚į”»‚č‚Ü‚¹‚ń‚Å‚µ‚½B
ˆź‰ž chdir ‚ĶƒAƒgƒ~ƒbƒN‚ȏˆ—‚Ģ‚Ķ‚ø‚Č‚Ģ‚ŃŠƒXƒN‰ń”š‚É–š—§‚Ā‚ĘŽv‚¢‚Ü‚·‚ęB‚»‚źˆČŠO‚É•ū–@‚Ŗ‚Č‚Æ‚ź‚ĪB
chdir ‚µ‚½‚ē rmdir ‚ą–Y‚ź‚ø‚ɁB

817 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/20(‰Ī) 17:06:03.57 ID:RIxgZ1yj
ŠŌˆį‚¦‚½Bchdir ‚¶‚į‚Č‚­‚Ä mkdir ‚Å‚·B

818 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/22(–Ų) 12:11:24.09 ID:nnsRF/zz
>>794
‚Ē‚¤‚ā‚ē >>801 ‚Å‘z‘œ‚µ‚½’Ź‚č sprintf ‚ĢŽd—l‚ē‚µ‚¢B
–{‘Ģ‚Ķ builtin.c ‚Ģ format_tree ŠÖ”‚ē‚µ‚¢B
Å‰‚É 512 ƒoƒCƒgŠm•Ū‚µ‚½ƒoƒbƒtƒ@‚Ķ‘å‚«‚­‚Ķ‚Č‚Į‚Ä‚ą¬‚³‚­‚Ķ‚Č‚ē‚Č‚¢B
ŽĄŪ‚Ģ•¶Žš—ń‚ɍ‡‚ķ‚¹‚ÄŠm•Ū‚µ‚Č‚Ø‚µ‚½‚ē‚Ē‚¤‚Č‚é‚© >>800 ‚ĢƒeƒXƒg‚š‚µ‚Ä‚Ż‚½‚ęB

‰ü‘¢‘O
element@@@@@@@@@@ before@ after@@diff
1@@@@@@@@@@@@@@ 2753@@4757@@2004
i@@@@@@@@@@@@@@ 2753@ 22357@ 19604
sprintf("%d",i)@@@@@@@ 2753@151283@148530
sprintf("%d",i) + 0@@@@@ 2753@ 22376@ 19623
sprintf("%d",i) ""@@@@@@2753@ 30174@ 27421

‰ü‘¢Œć
element@@@@@@@@@@ before@ after@@diff
1@@@@@@@@@@@@@@ 2753@@4757@@2004
i@@@@@@@@@@@@@@ 2753@ 22357@ 19604
sprintf("%d",i)@@@@@@@ 2753@ 30174@ 27421
sprintf("%d",i) + 0@@@@@ 2753@ 22373@ 19620
sprintf("%d",i) ""@@@@@@2753@ 30230@ 27477

‚ ‚źH jessie ‚Ģ gawk ‚Ę”ä‚ׂăƒ‚ƒŠ‚ĢŽg—p—Ź‚Ŗ­‚Č‚¢B
-DDEBUG •t‚«‚ŃRƒ“ƒpƒCƒ‹‚µ‚½‚©‚ē‘‚¦‚é‚©‚ĘŽv‚Į‚½‚Ģ‚ɁB
‚Ü‚ A‚»‚źˆČŠO‚Ķˆź‰ž—\‘z’Ź‚č‚Å‚Ķ‚ ‚éB

819 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/22(–Ų) 23:15:31.17 ID:SYBS8P/o
>>793‚Ę‚©
•¶Žš—ń‚Ģ˜AŒ‹‚Ķ "A" "B" ‚ę‚č‚ąsprintf("%s%s", "A", "B") ‚Ģ•ū‚Ŗ‘¬‚¢‚Ę‚©
gawk‚Į‚ÄŒ‹\ƒNƒZ‚ ‚č‚Ü‚·‚Ė

820 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/23(‹ą) 02:39:22.63 ID:o4qLonoN
>>819
> •¶Žš—ń‚Ģ˜AŒ‹‚Ķ "A" "B" ‚ę‚č‚ąsprintf("%s%s", "A", "B") ‚Ģ•ū‚Ŗ‘¬‚¢
ƒ}ƒW‚©B‹t‚¾‚Ę•·‚¢‚Ä‚¢‚½‚ŖB

821 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/23(‹ą) 16:06:39.19 ID:Y+5MXC/e
‚»‚ń‚ČƒoƒJ‚ȁcc‚ĘŽv‚Į‚Ä‚ā‚Į‚Ä‚Ż‚½B

https://ideone.com/jIYn2p

jessie —p‚ĢƒpƒbƒP[ƒW‚É‚ę‚鎥sŒ‹‰ŹB

i++@@@@@@@@@6.15614
i = i + 1@@@@@@6.02501
cat " and " dog@@@13.0163
sprintf@@@@@@@19.1612

ƒCƒ“ƒNƒŠƒƒ“ƒg‚Ę‘«‚µŽZ‚Ģ·‚Ķ—LˆÓ‚Ę‚ĶŽv‚¦‚Č‚¢B
˜AŒ‹‚Ę sprintf ‚Ģ·‚Ķ‘½•ŖA”{‚­‚ē‚¢B
sprintf ‚Ģ’†‚Ģ•”ŽG‚³‚šl‚¦‚ź‚ĪˆÓŠO‚ʍ·‚Ķ¬‚³‚¢‚Ę‚¢‚¦‚éB
ƒtƒH[ƒ}ƒbƒg•¶Žš—ń‚Ŗ’萔‚Č‚ē³‹K•\Œ»‚Ż‚½‚¢‚ɃRƒ“ƒpƒCƒ‹‚·‚ź‚Ī
‚‘¬‰»‚Å‚«‚écc‚Ģ‚©‚Č‚ ? Ž©•Ŗ‚Å‚ā‚Į‚Ä‚Ż‚ꂤ‚Ę‚Ķ(”‚Ķ‚Ü‚¾)Žv‚ķ‚Č‚¢B

822 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/24(“y) 23:15:47.76 ID:+IiHRmp0
Windows‚ÅŽg‚¦‚éawk‚ÅUnicode‚š³‚µ‚­ˆ—‚Å‚«‚éilength("‚ ‚¢‚¤")‚Å3‚Ŗ•Ō‚Į‚Ä‚­‚éj‚ą‚Ģ‚Ķ
Cygwin”Å‚ĘVector”ÅˆČŠO‚É–³‚¢‚Å‚µ‚傤‚©H

823 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/25(“ś) 10:08:34.07 ID:BH82R274
‰½‚Ŗ‚ ‚Į‚½‚ń‚Å‚·‚©?

http://tanimoto.to/nlp/jgawk/jgawk.html

‚ɏ‘‚©‚ź‚Ä‚¢‚é‚ꂤ‚Č‚±‚Ę‚Å‚·‚©? •Ź‚Ģ‘I‘šŽˆ‚ąˆź‰ž‚ ‚é‚Ż‚½‚¢‚Å‚·‚ŖB
ƒgƒ‰ƒ“ƒXƒŒ[ƒ^‚Å‚ą‚¢‚¢‚Č‚ē Perl ‚É a2p ‚Ŗ“ƍ«‚³‚ź‚Ä‚Ü‚·B

824 F822F2016/09/25(“ś) 14:28:36.60 ID:MNlfsMjx
“Į‚ɍ¢‚č‚²‚Ę‚Ķ–³‚¢‚Ģ‚Å‚·‚ŖAÅV‚ĢVer4.1.4‚ā‚»‚Ģ‹ß•Ó‚Ģƒo[ƒWƒ‡ƒ“‚Å
Unicode‚Ŗ³‚µ‚­ˆ—‚Å‚«‚é‚ą‚Ģ‚Ŗ‚ ‚ź‚ĪA”Žg‚Į‚Ä‚¢‚éBruce”Å3.1.7‚©‚ē
ę‚芷‚¦‚½‚¢‚Č‚ ‚ĘŽv‚¢‚Ü‚µ‚āB

«‚Ģ5”N‘O‚ɏ‘‚©‚ź‚½‹LŽ–‚Ģ ‚ę‚č‘I‘šŽˆ‚Ŗ‘‚¦‚½‚肵‚Ä‚½‚ēŠš‚µ‚¢‚ȂʁEEEB
http://blog.livedoor.jp/corbie/archives/3924154.html

825 F823F2016/09/26(ŒŽ) 09:17:05.22 ID:bhAuZr+w
—‰š‚µ‚Ü‚µ‚½B‘S–Å‚¾‚Į‚½‚ń‚Å‚·‚ĖB
Windows ‚Å‚ĢŽ–ī‚Ķ‘¶‚¶‚Ü‚¹‚ń‚ŖA‚±‚æ‚ē‚Å‚ąŽę‚č‹}‚¬ gawk 3.1.5 ‚š make ‚µ‚Ä‚Ż‚Ü‚µ‚½B
‚Ę‚±‚ė‚ŁA‚»‚Ģƒy[ƒW‚ĢƒeƒXƒg3‚Ķ•s\•Ŗ‚Å‚·B
UTF-8 ‚Å‚Ģƒpƒ^[ƒ“ƒ}ƒbƒ`‚Ķ’Źķ•¶Žš‚ĢŒėƒ}ƒbƒ`‚ĶŒ“—“I‚É‹N‚±‚č‚Ü‚¹‚ńB‹N‚±‚Į‚½‚ēƒoƒO‚Å‚·B
‚¾‚©‚ēAUTF-8 ‚É‘Ī‰ž‚µ‚Ä‚¢‚é‚©‚Ē‚¤‚©‚šƒeƒXƒg‚·‚邽‚ß‚É
sub(/.‚¤/, "U")
‚Ę‚¢‚¤‚ꂤ‚Č‚ą‚Ģ‚š“ü‚ź‚ÄŽŽ‚µ‚Ä‚Ż‚Ü‚µ‚½B
”ƒrƒ‹ƒh‚µ‚½‚Ī‚©‚č‚Ģ gawk 3.1.5 ‚Ę jessie ‚ĢƒpƒbƒP[ƒW‚Ģ gawk 4.1.1 ‚Ŗ‚±‚ĢƒeƒXƒg‚ɍ‡Ši‚µ‚Ü‚µ‚½B
mawk 1.3.3 ‚ąƒCƒ“ƒXƒg[ƒ‹‚³‚ź‚Ä‚Ü‚µ‚½‚ŖA‚±‚æ‚ē‚Ķƒ}ƒ‹ƒ`ƒoƒCƒg•¶Žš‚É‘Ī‰ž‚µ‚Ä‚¢‚Č‚¢‚ꂤ‚Å‚·B

‚³‚āAŒ‹˜_‚Å‚·B
ƒVƒtƒgJIS ‚É‘Ī‰ž‚µ‚Ä‚¢‚é‚Ę‚³‚ź‚é‚ą‚Ģ‚Ķ”š‚Æ‚½•ū‚Ŗ‚¢‚¢‚ĘŽv‚¢‚Ü‚·B
—]Œv‚ȉü‘¢‚Ķ‚µ‚Č‚¢•ū‚ŖM—Š«‚Ķ‚‚¢‚Å‚µ‚傤B
length ‚ŖƒoƒCƒg”‚Č‚Ģ‚ĶA’P‚Ƀ}ƒ‹ƒ`ƒoƒCƒg•¶Žš”ń‘Ī‰ž‚ŃRƒ“ƒpƒCƒ‹‚³‚ź‚Ä‚é‚©‚ē‚¾‚ĘŽv‚¢‚Ü‚·B
ƒ}ƒ‹ƒ`ƒoƒCƒg•¶Žš‘Ī‰ž”Å‚š’N‚©‚ŖƒŠƒŠ[ƒX‚µ‚Ä‚­‚ź‚é‚Ģ‚š‘Ņ‚Ā‚©AŽ©•Ŗ‚ŃRƒ“ƒpƒCƒ‹‚·‚é‚©‚Å‚·‚ĖB

826 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/27(‰Ī) 17:33:47.16 ID:Icjzq3KF
Linux ‚Å‚ĶŠĀ‹«•Ļ” LANG ‚É UTF-8 ‚Ŗ“ü‚Į‚Ä‚Č‚¢‚ĘŠś‘Ņ’Ź‚č‚É“®‚¢‚Ä‚­‚ź‚Ü‚¹‚ńB
³Šm‚É‚Ķ LANG ‚Ę‚¢‚¤‚ę‚č LC_CTYPE ‚Å‚·‚ŖA‚»‚ź‚Ķ‚Ø‚¢‚Ę‚¢‚āB
‚ą‚µ‚©‚µ‚½‚ē‚ĘŽv‚Į‚āAŽ©•Ŗ‚É‚Ķ–³—p‚¾‚ĘŽv‚Į‚Ä‚½ Wine ‚Å klabaster gawk 4.1.3 ‚š“®‚©‚µ‚Ä‚Ż‚Ü‚µ‚½B
‚Ę‚±‚ė‚ŖA³‹K•\Œ»‚Ƀ}ƒ‹ƒ`ƒoƒCƒg•¶Žš‚ŖŒ»‚ź‚½Žž“_‚Å“{‚ē‚ź‚Ü‚·B
‚Ē‚¤‚ā‚ē LANG ‚Ŗ–³‚¢‚©ALANG=C ‚¶‚į‚Č‚Æ‚ź‚Īƒ}ƒ‹ƒ`ƒoƒCƒg•¶Žš‚šŽg‚¦‚Č‚¢‚ꂤ‚Å‚·B
‚»‚µ‚ÄŒ‹‹ĒA³‹K•\Œ»‚Ģ . ‚ā length ‚š UTF-8 ƒ‚[ƒh‚É‚·‚é•ū–@‚ĶŒ©‚Ā‚Æ‚ē‚ź‚Ü‚¹‚ń‚Å‚µ‚½B
‹LŽ–‚ĢƒRƒƒ“ƒg‚É‚Ķ LC_ALL=ja_JP.UTF-8 ‚Å“®‚­‚Į‚ď‘‚¢‚Ä‚ ‚é‚Ģ‚ɁB
‚Š‚å‚Į‚Ę‚µ‚āAWindows ‚Å‚ĶŒ“—“I‚É‚Å‚«‚Č‚¢‚Ę‚¢‚¤‚±‚Ę?
‚±‚ź‚Ķ‚¢‚ę‚¢‚ę a2p ‚ŖŒ»ŽĄ“I‚Č‘I‘šŽˆ‚©?
cc‚ĘŽv‚Į‚½‚ēAo—Ķ‚·‚é Perl ƒR[ƒh‚ŖŠŌˆį‚Į‚Ä‚Ü‚·B

‚ą‚¤~ŽQ‚Å‚·BUTF-8 ‘Ī‰ž‚Ģ gawk ‚š‚Ø–]‚Ż‚Ģ•ū‚É‚Ķ Linux ‚Ö‚Ģˆų‰z‚µ‚š‹­‚­‚؏§‚ß‚µ‚Ü‚·B

827 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/27(‰Ī) 18:24:36.25 ID:JiNhKH2a
cygwin‚āmsys2‚Ģgawk‚šŽg‚¤‚Ģ‚Ķ‚¾‚ß‚Č‚ĢH

828 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/27(‰Ī) 18:34:39.64 ID:BPXrtVfk
Windows Subsystem for Linux (WSL)‚Å‚ĶAUbuntu64‚ĢŽĄsƒtƒ@ƒCƒ‹‚Ŗ“®‚­B
Linux API ‚šAWindows API ‚Ö•ĻŠ·‚µ‚ÄŒÄ‚Ńo‚·

Ubuntu‚ĢƒpƒbƒP[ƒW‚ąAapt-get‚ŃCƒ“ƒXƒg[ƒ‹‚Å‚«‚é

829 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/27(‰Ī) 19:26:43.05 ID:Icjzq3KF
‚¾‚ß‚Ę‚¢‚¤‚©AŒ©‚Ā‚Æ‚ē‚ź‚Č‚©‚Į‚½B
‚½‚¾‚Å‚³‚¦ Windows ‚Ģ‚±‚Ę‚Č‚ń‚©’m‚ē‚Č‚¢‚ń‚¾‚©‚ē‚±‚źˆČć–³—B
‚¢‚¢•ū–@‚š’m‚Į‚Ä‚½‚ē‹³‚¦‚Ä‚ ‚°‚āB

830 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/27(‰Ī) 19:51:11.26 ID:Icjzq3KF
Cygwin ‚ĶŽŽ‚µ‚Ä‚Ż‚½‚Æ‚ĒƒCƒ“ƒXƒg[ƒ‰‚É’šd‚É‚Ø’f‚č‚³‚ź‚½‚ęB

831 F822F2016/09/27(‰Ī) 23:10:22.59 ID:eGFFwbsN
‚½‚­‚³‚ń‚Ģī•ń‚ ‚č‚Ŗ‚Ę‚¤‚²‚“‚¢‚Ü‚·BŒ»ó‚ÅWindows‚ɍS‚é‚Č‚ēABruce”Å3.1.7‚šŒp‘±‚µ‚Ä
Žg—p‚·‚é‚©ACygwin”łɏę‚芷‚¦‚é‚©AWindows Subsystem for Linux‚Å“®ģ‚³‚¹‚é‚©‚Ģ
‚¢‚ø‚ź‚©‚É‚Č‚č‚»‚¤‚Å‚·‚ĖB

Cygwin‚āWindows7‚Å‚ĢWindows Subsystem for Linux‚ĶA‚Ē‚æ‚ē‚ą•Ź“rƒCƒ“ƒXƒg[ƒ‹‚Ŗ•K—v
‚Ę‚Ģ‚±‚Ę‚Č‚Ģ‚ŁAEź‚ĢŽ©PC‚Ķ‚Ę‚ą‚©‚­ƒXƒNƒŠƒvƒg”z•zę‚ɁiƒXƒNƒŠƒvƒg‚š“®‚©‚·‚½‚ß‚¾‚ƂɁj
“±“ü‚µ‚Ä‚ą‚ē‚ķ‚Č‚¢‚Ę‚¢‚Æ‚Č‚¢‚Ģ‚Ķ‚æ‚å‚Į‚Ę“ļ‚µ‚»‚¤‚Å‚·B
Cygwin‚Ģ“±“üó‹µ‚ĘWindows10‚Ö‚ĢŲ‚č‘Ö‚¦ŽžŠś‚Ģ—lŽq‚šŒ©‚Ā‚ĀA‚µ‚Ī‚ē‚­Bruce”Å3.1.7‚š
Žg‚¤‚±‚Ę‚É‚µ‚Ü‚·B

832 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/09/28(…) 07:26:06.87 ID:6NcLFLen
ŽĄ‚Ķ•ū–@‚Ŗ–³‚¢‚ķ‚Æ‚Å‚Ķ‚Č‚¢BƒVƒ“ƒOƒ‹ƒoƒCƒgƒ‚[ƒh‚Č‚ē‚Å‚«‚éB‚Å‚ą–{“–‚É‚ā‚č‚½‚¢?
–{“–‚ɐ^Œ•‚É•K—v‚Ę‚µ‚Ä‚¢‚é‚Č‚ēA‚±‚ĢƒXƒNƒŠƒvƒg‚ŃeƒXƒg3‚š‚ā‚Į‚Ä‚Ż‚Ä‚Ł‚µ‚¢B

{
@@c = "[\\000-\\177]|[\\340-\\357][\\200-\\277][\\200-\\277]"
#@ print( length($0));
@@str = $0; print( gsub( c,"0",str));
@@print;
@@sub(/<tag>/, "");
@@sub(/<\/tag>/, "");
@@sub(/hello/, "ABC");
#@ sub(/.‚¤/, "U");
@@sub( sprintf("(%s)‚¤",c),"U")
@@print;
}

833 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/10/01(“y) 22:37:26.49 ID:apxhHWta
‚ā‚Į‚Ļ‚č klabaster gawk ‚Ķ‚ę‚­‰š‚ē‚Č‚¢B

$cat u2.awk
{
@@print( length($0))
@@sub(/‚¤/, "U")
@@print;
}
$LANG=C wine ../gawk64.exe -f u2.awk u2.txt > /dev/null
$LANG=ja_JP.EUC-JP wine ../gawk64.exe -f u2.awk u2.txt > /dev/null
$LANG=ja_JP.UTF-8 wine ../gawk64.exe -f u2.awk u2.txt > /dev/null
gawk64: u2.awk:3: sub(//, "U")
gawk64: u2.awk:3: ^ unterminated regexp
gawk64: u2.awk:4: sub(//, "U")
gawk64: u2.awk:4: ^ unexpected newline or end of string
$

UTF-8 ‚Łu‚¤v‚Ķ 3 ƒoƒCƒg‚¾‚©‚ēAƒVƒtƒgJIS‚ʼnšŽß‚µ‚½Œ‹‰Ź
‚»‚ĢŒć‚ė‚Ģ / ‚ąƒ}ƒ‹ƒ`ƒoƒCƒg•¶Žš‚Ģˆź•”‚É‚Č‚é‚Ģ‚¾‚ė‚¤‚©B
‚¢‚āAUTF-8 ‚ʼnšŽß‚µ‚Ä‚­‚ź‚Č‚¢‚±‚Ę‚É•¶‹å‚šŒ¾‚¢‚½‚¢‚ń‚¶‚į‚Č‚¢‚ń‚¾B
UTF-8 ‚ŏ‘‚¢‚Ä‚ ‚é‚Ģ‚É‚Č‚ŗ LANG=ja_JP.UTF-8 ‚ĢŽž‚¾‚ƃGƒ‰[‚É‚Č‚é‚Ģ‚¾‚ė‚¤B

834 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/10/02(“ś) 00:14:27.80 ID:lSw/Qfuv
‚±‚Ģ‹LŽ–‚šŒ©‚é‚©‚¬‚č‚Å‚ĶklabasterˆČŠO‚ĢWindows”Ågawk‚Å‚ąƒ_ƒ‚Į‚Ū‚¢‚Å‚·
https://groups.google.com/forum/#!topic/comp.lang.awk/coXxXOpeoXU

835 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/10/08(“y) 21:51:54.06 ID:66+5bUgM
>>749‚©‚ē‚ĢƒŒƒX‚ŁA$‚Ŗ‰‰ŽZŽq‚¾‚Į‚½‚ĢH@‚Ę‚¢‚¤‚ꂤ‚Č‚Ę‚±‚ė‚Ŗ‹C‚É‚Č‚Į‚Ä
­‚µ’²‚ׂĂŻ‚½i’²‚ׂ½‚Ę‚¢‚¤‚Ł‚Ē‚Ģģ‹Ę‚Ķ‚µ‚Ä‚Č‚¢‚©jB

‚Ü‚ø‘ŠBŽčŽ‚æ‚Ģ”ū‚ÅŠm”FB
wƒvƒƒOƒ‰ƒ~ƒ“ƒOŒ¾ŒźAWKxiƒgƒbƒpƒ“@‰”Å‘ę7üj
‚³‚¢‚²‚Ģ‚Ü‚Ę‚ß‚Å‰‰ŽZŽqˆź——‚É‹LŚB–{•¶’†(p8)‚Å‚Ķu—“‚Ķķ‚É$1,$2‚Ģ‚ꂤ‚É
ŽQĘ‚µ‚Č‚­‚Ä‚Ķ‚¢‚Æ‚Č‚¢‚ĘŽv‚ķ‚ź‚Ä‚¢‚é‚©‚ą‚µ‚ź‚Č‚¢‚ŖAŽĄ‚Ķ$‚Ģ‚ ‚Ę‚É‚Ķ,—“‚Ģ
”Ō†‚šŽw‚µŽ¦‚·‚½‚ß‚Ģ”CˆÓ‚ĢŽ®‚š‘‚¢‚Ä‚ą‚ę‚¢v‚ʏ‘‚©‚ź‚Ä‚¢‚éB‚Ü‚½Ap46‚É‚Ķ
u—“•Ļ”v‚Ģ€‚Ɂu“ü—Ķs‚Ģ—“ifieldj‚Ķ,$1,$2‚©‚ēŽn‚Ü‚Į‚Ä,$NF‚Ę‚¢‚¤–¼‚ŌĂĪ‚ź‚év
‚Ę‚Ģ‹Lq‚Ŗ‚ ‚éB

wsed & awk ƒvƒƒOƒ‰ƒ~ƒ“ƒOxiƒAƒXƒL[o”Å‹Ē@‰”Łj
‹Œ”ŁB–{•¶’†ip212j‚ŁuƒtƒB[ƒ‹ƒh‚šŽQĘ‚µ‚½‚¢‚Ę‚«‚É‚ĶAƒtƒB[ƒ‹ƒh‰‰ŽZŽq$‚šŽg‚¦‚Ī‚ę‚¢v
‚Ü‚½ip217j‚ŁuƒtƒB[ƒ‹ƒh‚šŽQĘ‚·‚é‚É‚Ķƒhƒ‹‹L†($)‰‰ŽZŽq‚šŽg‚¤vAAppendixip471j‚Å
u‚»‚ź‚¼‚ź‚ĢƒtƒB[ƒ‹ƒh‚ĶA$1‚Č‚ē‚ĪÅ‰‚ĢƒtƒB[ƒ‹ƒh‚Ģ’l‚šŽQĘ‚µAv‚Ę•\Œ»‚³‚ź‚Ä‚¢‚éB
Appendix‚Ģ‰‰ŽZŽqˆź——‚É‹LŚB

wAWK‚š256”{Žg‚¤‚½‚ß‚Ģ–{xiƒAƒXƒL[o”Å‹Ē@‰”Łj
Appendix‚ʼn‰ŽZŽqˆź——‚É‹LŚ‚³‚ź‚Ä‚¢‚é‚ŖA–{•¶ip65j‚Łu•Ŗ‰š‚³‚ź‚½ŠeƒtƒB[ƒ‹ƒh‚ĶA
$n‚Ę‚¢‚¤•Ļ”in‚ĶAŽn‚ß‚ĢƒtƒB[ƒ‹ƒh‚©‚ē‡‚É1,2,3...‚Ę‚Č‚éB‚ą‚æ‚ė‚ń‘¦’l‚Ģ‘ć‚ķ‚č‚É•Ļ”‚š
Žw’č‚·‚邱‚Ę‚ą‰Ā”\‚¾j‚ŃAƒNƒZƒX‚·‚邱‚Ę‚Ŗ‚Å‚«‚év‚Ę‚ ‚éB‘¼‚Ģ‰ÓŠ‚Å‚ą$n•Ļ”‚ʏ‘‚¢‚Ä‚ ‚é
‚Ę‚±‚ė‚Ŗ‚ ‚éBp66‚ŁuŠeƒtƒB[ƒ‹ƒh‚š•\‚·$n‚Å‚ ‚é‚ŖA‚Č‚ŗ‚±‚ń‚Č–¼‘O‚É‚Č‚Į‚Ä‚¢‚é‚©‚²‘¶‚¶‚¾‚ė‚¤‚©H
ŽĄ‚Ķ‚±‚ź‚ąUNIX•¶‰»‚©‚ē‚«‚Ä‚¢‚é‚Ģ‚¾BUNIX‚Ģ‘ć•\“I‚ČƒVƒFƒ‹‚Å‚ ‚ésh‚ācshiÅ‹ß‚Å‚Ķksh‚ā
tcsh‚©‚ȁHj‚ĢƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚Ģ‚Č‚©‚ŃRƒ}ƒ“ƒhƒ‰ƒCƒ“ƒpƒ‰ƒ[ƒ^‚š•\‚·•Ļ”‚Ę‚µ‚Ä$n‚ŖŽg—p‚³‚ź‚Ä
‚Ø‚či’†—Ŗj‚±‚ź‚É‚ ‚ķ‚¹‚Äawk‚Å$n‚ŖŽg—p‚³‚ź‚Ä‚¢‚é‚ꂤ‚Č‚Ģ‚Å‚ ‚év‚ʏ‘‚¢‚Ä‚ ‚éB

wAWKŽĄ‘H“ü–åxi‹Zp•]˜_ŽŠ@‰”Łj
>>766‚É‚ ‚é‚ꂤ‚É“Į•Ź‚Č•Ļ”‚Ę‚µ‚Ĉµ‚ķ‚ź‚Ä‚Ø‚čAƒŠƒtƒ@ƒŒƒ“ƒX‚É‚ą$‚Ŗ‰‰ŽZŽq‚Å
‚ ‚邱‚Ę‚Ģ‹LŚ‚Ŗ‚Č‚¢B
i‘±‚­j

836 F835F2016/10/08(“y) 22:00:44.45 ID:66+5bUgM
i‘±‚«j
ƒlƒbƒg‚Ģī•ńB2016.10.8Œ»ŻB
Gnu Awk ƒ†[ƒU[ƒYƒKƒCƒh/The GAWK Manual/Effective AWK Programming
gawk‚Ģ‰šą‘Bƒo[ƒWƒ‡ƒ“ˆį‚¢‚Ŗ‚ ‚é‚ꂤ‚¾‚ŖA–|–ó”Å‚Å–Ś‚É—Æ‚Ü‚Į‚½‚ą‚ĢB
u’萔‚Å‚Č‚¢ƒtƒB[ƒ‹ƒh”Ō†v‚Ģ€‚Łu‚ ‚éƒtƒB[ƒ‹ƒh‚šŽQĘ‚·‚邽‚߂ɁAawkŒ¾Œź‚Å‚Ģ”CˆÓ‚ĢŽ®‚š
`$'‚ĢŒć‚ÅŽg‚¤‚±‚Ę‚Ŗ‚Å‚«‚év‚Ę‹Lq‚³‚ź‚Ä‚¢‚éBu‰‰ŽZŽq‚Ģ—Dę‡ˆŹv‚Ģ€‚Å‚Ķ‰‰ŽZŽq‚Ę‚µ‚Ä
•Ą‚ׂē‚ź‚Ä‚¢‚éB

man gawk
–|–ó”ŁAƒŠƒiƒbƒNƒXƒRƒ}ƒ“ƒh‚Ę‚¢‚¤ƒTƒCƒgiwww.linux-cmd.comj‚©‚ēB
u“ü—ĶƒŒƒR[ƒh’†‚ĢŠeƒtƒB[ƒ‹ƒh‚Ģ’l‚ĶA¶‚©‚ē $1, $2 “™‚Ę‚¢‚¤–¼‘O‚ÅŽQĘ‚Å‚«‚Ü‚·B
$0 ‚ĶƒŒƒR[ƒh‘S‘Ģ‚Å‚·BƒtƒB[ƒ‹ƒh‚É’l‚š‘ć“ü‚·‚邱‚Ę‚ą‚Å‚«‚Ü‚·BƒtƒB[ƒ‹ƒh‚Ķ’萔‚¾‚Æ‚Å‚Č‚­A
•Ļ”‚É‚ę‚Į‚ÄŽQĘ‚·‚邱‚Ę‚ą‚Å‚«‚Ü‚·Bv‚Ę‚Č‚Į‚Ä‚¢‚éB‰‰ŽZŽq‚Ģ‚Ę‚±‚ė‚É‹LŚ‚ ‚čB

AWK Users JP
ƒTƒCƒg’†uawk Šī‘b•¶–@Å‘¬ƒ}ƒXƒ^[v‚Ģƒy[ƒW‚Łu“ĮŽź•Ļ”v‚Ģ€‚É$0,$1`$NF‚Ģą–¾B
ƒtƒB[ƒ‹ƒhŽQĘ‚ĢŒź‚Ķ‚Č‚¢B‚Ü‚½AƒŠƒtƒ@ƒŒƒ“ƒX“I‚ȉ‰ŽZŽq‚Ģ‚Ü‚Ę‚ß‚Ķ‚Č‚¢iHjB
ƒy[ƒWć•”‚Ɂu‚±‚Ģ•¶‘‚Ķ‘‚«‚©‚Æ‚Å‚·v‚Ę‚ ‚é‚Ģ‚ŁA–¢®”õ‚Ę‚¢‚¤‚±‚Ę‚¾‚ė‚¤‚©B

IBM Knowledge Center
awkƒRƒ}ƒ“ƒh‚Ģƒy[ƒWiwww.ibm.com/support/knowledgecenter/ja/ssw_aix_71/
com.ibm.aix.cmds1/awk.htmj‚Å‚ĶuƒŒƒR[ƒh‚ĘƒtƒB[ƒ‹ƒh‚É‚ę‚éƒtƒ@ƒCƒ‹ˆ—v‚Ģ€‚Å
uŠeƒtƒB[ƒ‹ƒh‚ĶƒtƒB[ƒ‹ƒh•Ļ”‚É‚ę‚Į‚ÄŽQĘ‚³‚ź‚Ü‚·BƒŒƒR[ƒh‚ĢÅ‰‚ĢƒtƒB[ƒ‹ƒh‚É‚Ķ $1 •Ļ”A
2 ”Ō–Ś‚ĢƒtƒB[ƒ‹ƒh‚É‚Ķ $2 •Ļ”‚Ę‚¢‚¤‚ꂤ‚ɁA•Ļ”‚ŖŠ„‚č“–‚Ä‚ē‚ź‚Ü‚·Bv‚Ę‚Ģ‹LqB­‚µ‚¤‚µ‚ė‚Ģ
•ūAuƒtƒB[ƒ‹ƒh•Ļ”v‚Ģ€‚Å‚ąuƒtƒB[ƒ‹ƒh•Ļ”‚ĶA$ (ƒhƒ‹‹L†) ‚Ę‚»‚ź‚É‘±‚­”’l‚Ü‚½‚Ķ”’lŽ®‚Å
Žw’肵‚Ü‚·Bv‚Ę‚ ‚éB$‚Ŗ‰‰ŽZŽq‚Å‚ ‚邱‚Ę‚Ģ‹LŚ‚Ķ‚Č‚¢B

‚Ä‚ČŠ“‚¶‚ŁAwƒvƒƒOƒ‰ƒ~ƒ“ƒOŒ¾ŒźAWKx‚Å‚ąu—“•Ļ”v‚Ę‚¢‚¤•\Œ»‚Ŗ‚ ‚čAŒė‰š‚µ‚»‚¤‚ČŠ“‚¶‚Ķ‚·‚éB
‚Ü‚½A256”{–{‚ɏ‘‚¢‚Ä‚ ‚é‚ꂤ‚ɃVƒFƒ‹ƒXƒNƒŠƒvƒg’†‚Ģƒpƒ‰ƒ[ƒ^‚Ę‚µ‚Ä$n‚Ŗ‚ ‚邱‚Ę‚©‚ēA$n‚Ŗ
i“Į•Ź‚ȁj•Ļ”‚Ę‚µ‚Ä”FŽÆ‚³‚ź‚Ä‚µ‚Ü‚Į‚Ä‚¢‚é‚Ģ‚Å‚Ķ‚Č‚¢‚©A‚Ę‚ą‘z‘œ‚·‚éBŒĀlƒTƒCƒg‚Ģawk‚Ģ‰šą
ƒy[ƒW‚Å‚ĶA$n‚Ę‚¢‚¤•Ļ”‚ɃtƒB[ƒ‹ƒh‚Ŗ‘ć“ü‚³‚ź‚é‚ʐą–¾‚µ‚Ä‚¢‚é‚Ę‚±‚ė‚ą‚ ‚Į‚½B‚»‚Ģ‚ꂤ‚É—‰š‚µ‚Ä
ƒXƒNƒŠƒvƒg‚š‘‚¢‚Ä‚ą‚³‚µ‚Ä•s“s‡‚Ķ‚Č‚¢‚¾‚ė‚¤‚ȁA‚Ę‚ĶŽv‚¤‚ŖB

837 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/10/08(“y) 23:11:50.50 ID:ZMh6U7O9
L”Ķ‚Č’²ø‰³BGawk‚Ģrefcard‚Å‚ą‚æ‚į‚ń‚Ęoperator‚ÉŠÜ‚Ü‚ź‚Ä‚¢‚é‚Č‚ B
‰‰ŽZŽq‚Ę–¾Šm‚É”FŽÆ‚µ‚Ä‚¢‚Č‚­‚Ä‚ąA$‚ĢŒć‚ÉŽ®OK‚ĘŽv‚Į‚Ä‚¢‚ź‚Ī·‚µŽx‚¦‚Č‚³‚»‚¤B

838 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/10/18(‰Ī) 23:10:18.54 ID:TQpGgbw6
gawk4‚Ŋ֐”ƒ|ƒCƒ“ƒ^‚Ż‚½‚¢‚Č‚ą‚ń‚Ŗ’Ē‰Į‚³‚ź‚Ü‚µ‚½‚Æ‚ĒA‚±‚źlength‚Ę‚©substr‚Ģ
‘gž‚ŻŠÖ”‚ā@load‚µ‚½Ž©ģdll‚ĢŠÖ”‚Ę‚©‚É‚ąŽg‚¦‚é‚ń‚Å‚·‚Ė
ˆÄŠO•Ö—˜‚©‚ą

@load "hage.dll"
@BEGIN{
@kumi = "length"
@func = "hagefunc"
@ng[1] = "substr"
@print @kumi("ABC")
@print @func("œc Ü ƒ~ ")
@print @ng[1]("XYZ", 1, 1) # ”z—ń‰z‚µ‚ɌĂŚ‚¤‚Ę‚µ‚½‚ēsyntax errorEEEŽc”O
}

839 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/10/21(‹ą) 17:10:59.85 ID:MQQBNMPM
>>756
‚±‚¤‚¢‚¤‰ß‘aƒXƒŒ‚Å–³‘Ź‚É“Ė‚Į‚©‚©‚Į‚Ä‚­‚é‚ā‚Ā‚Ž‚©‚Ā‚­‚ń‚¾‚ŖŽ€‚Ė

840 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/11/23(…) 00:01:26.03 ID:bt3mTQnz
>>839
ƒu[ƒƒ‰ƒ“‚©‚ę‚—‚—‚—

841 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/11/23(…) 01:18:15.98 ID:noM2Pdp3
_‚Ø‚Ķ‚°‚¾[I^

842 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2016/11/30(…) 02:56:38.28 ID:PeC/aWZc
http://imgur.com/a/1WEjn

843 F‚b‰SŽŅF2017/02/28(‰Ī) 13:18:15.09 ID:Mb8mQo1M
‚‚—‚‹ƒXƒNƒŠƒvƒg‚š‚bƒ\[ƒX‚É•ĻŠ·‚µ‚ăRƒ“ƒpƒCƒ‹‚·‚邽‚ß‚Ģu‚‚—‚‹‚v‚Ę‚¢‚¤ƒc[ƒ‹‚Å‚Å‚«‚邾‚ÆŠČ’P‚É‚t‚s‚e|‚WƒTƒ|[ƒg‚³‚¹‚é•ū–@‚š’m‚č‚½‚¢‚Å‚·B
ƒlƒbƒg‚ÅŽUX’²‚ׂ܂µ‚½‚Ŗ‚Č‚¢‚ꂤ‚Å‚·H

844 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2017/03/02(–Ų) 00:28:53.73 ID:CDxvUfiY
‚±‚ĢƒXƒŒ‚ą‚P‚OŽü”N‚©

845 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2017/03/05(“ś) 09:28:55.73 ID:EQCsqksH
>>843
‚»‚ź‚Ŗ‚ ‚Č‚½‚ĢŒ»Ż‚ĢŽĄ—Ķ‚¾‚Į‚½‚Ę‚¢‚¤‚±‚Ę‚Å‚·
‚Ø”ę‚ź—l‚Å‚µ‚½

846 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2017/03/05(“ś) 14:45:26.28 ID:KmKKYedf
gawk‚É‘Ī‰ž‚µ‚Ä‚é‚Č‚ē‘åä•v‚Į‚Ä‚±‚Ę‚©‚ȁH
ascii‚µ‚©l‚¦‚Ä‚¢‚Č‚¢‚Č‚ēAƒ\[ƒX‘Sƒ`ƒFƒbƒNcB
—v‚·‚é‚ɁA“ś–{Œź‰»‚·‚é‚ń‚¾‚ė‚¤‚Æ‚ĒB

‘S‘R•Ź‚ĢŒ¾Œź•ĻŠ·‚É‚æ‚å‚Į‚Ę™ł‚ń‚¾‚±‚Ę‚Ŗ‚ ‚é‚ń‚¾‚Æ‚ĒA
»•i‰»‚µ‚æ‚į‚Į‚Ä‚©‚ēƒ_ƒuƒ‹ƒoƒCƒgl—¶‚µ‚Ä‚Č‚¢‚±‚Ę‚Ŗ‚ķ‚©‚Į‚āA‚©‚Č‚č–Ź“|‚¾‚Į‚½B

‚Ę‚č‚ ‚¦‚ø•ĻŠ·‚µ‚Ä‚©‚ēAƒ\[ƒXŒ©‚Ä’¼‚·‚Ł‚¤‚Ŗ‘‚©‚Į‚½‚čiĪ

‚Ŗ‚ń‚Ī‚Į‚Ä‚ĖB

847 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2017/03/06(ŒŽ) 11:39:31.22 ID:FdaYmB9f
awk‚Ł@$1,$2...$6 ‚±‚ń‚ȏo—Ķ‚š«‰ŗ‚É‚µ‚½‚¢‚ń‚¾‚Æ‚Ē@‚Ē‚¤‚·‚ź‚Ī‚¢‚¢‚Å‚·‚©‚ĖH
470230
470290
«
002347
002479

848 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2017/03/06(ŒŽ) 12:33:46.83 ID:FW5jfGh1
GNU awk ‚Ģ asort() ‚šŽg‚¤‚Ę‚©B

printf '470230\n470290\n' |
gawk -vFS= -vOFS= '{
for(i=1;i<=NF;i++){
arr[i]=$i
};
asort(arr);
for(i=1;i<=NF;i++){
$i=arr[i]
};
print
}'

849 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2017/03/06(ŒŽ) 15:19:43.83 ID:FdaYmB9f
‚ ‚č‚Ŗ‚Ę‚¤
gawk ‚¢‚ź‚Č‚¢‚Å‚Č‚ń‚Ę‚©‚Č‚ē‚Č‚¢‚©‚Č

850 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2017/03/06(ŒŽ) 17:28:40.15 ID:FW5jfGh1
‚¤`‚ńA‚»‚¤‚Č‚é‚Ę awk ‚šŽg‚ķ‚Č‚­‚Ä‚ą‚¢‚¢‚©‚Č

printf '470230\n470290\n' |
while read -r n
do
echo "$n" | grep -o . | sort -n | tr -d '\n'; echo
done

851 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2017/03/06(ŒŽ) 19:23:27.89 ID:08XsJPyW
>>840
‚¾‚©‚ēƒu[ƒƒ‰ƒ“‚Ę‚©‚»‚¤‚¢‚¤‚ĢŠÖŒW‚Č‚¢‚©‚ēŽ€‚Ė‚Į‚ÄŒ¾‚Į‚Ä‚ń‚¾‚ėƒJƒX
Ž€‚Ė

852 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2017/03/06(ŒŽ) 19:24:30.15 ID:08XsJPyW
>>844
”S’…‚Ŗ10”NˆŹ‰„–½‚µ‚Ä‚ą‰½‚ą‚·‚²‚­‚Ė‚¦‚ę
“Ė‚Į‚©‚©‚Į‚Ä‚«‚½‚Ō‚悱‚ė‚·‚¼ŽG‹›Ž€‚Ė>>840

853 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2017/03/06(ŒŽ) 19:26:33.18 ID:08XsJPyW
>>840
ƒu[ƒƒ‰ƒ“‚Ę‚©‚¶‚į‚Č‚­‚ÄŽ€‚Ė‚Į‚ÄŒ¾‚Į‚Ä‚ń‚¾‚©‚ēŽ€‚Ėƒ{ƒP

854 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2017/03/07(‰Ī) 08:17:48.93 ID:6Hf5Xh2e
‚Ø”ę‚ź—l‚Å‚µ‚½

855 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2017/03/09(–Ų) 21:48:39.65 ID:0T9qj2kA
˜A‘z”z—ń‚Å
echo '470230' | awk 'BEGIN{FS=""}{for(i=1;i<=NF;i++){a[$i]++}for(i=0;i<=9;i++){for(j=1;j<=a[i];j++){printf("%s", i)}}printf("\n")}'
002347

856 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2017/03/10(‹ą) 00:18:57.87 ID:+B1nKlhG
Šł‚É”Ū’č‚³‚ź‚Ä‚¢‚é‚Ŗgawk4‚Ŗ‚ą‚µŽg‚¦‚½‚ē
awk '{ORS="";PROCINFO["sorted_in"]="@val_num_asc";x=split($0,a,"");for (i in a)print a[i];print "\n"}'

857 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2017/03/10(‹ą) 04:05:38.25 ID:wGo6zQ56
Å‹ß‚Ģ gawk ‚Č‚ēƒCƒ“ƒNƒ‹[ƒhƒtƒ@ƒCƒ‹‚Ŗ—pˆÓ‚³‚ź‚Ä‚Ä join ‚Ę‚©Žg‚¦‚½‚č

gawk -vFS= -vOFS= -i join.awk '{split($0,a,"");asort(a);print join(a,1,length(a),SUBSEP)}'

858 FƒfƒtƒHƒ‹ƒg‚Ģ–¼–³‚µ‚³‚ńF2017/04/04(‰Ī) 22:35:43.00 ID:9/WMFGSO
# gawk4‚Ģ“Ēž‚Żƒ^ƒCƒ€ƒAƒEƒg‹@”\A‚Æ‚Į‚±‚¤•Ö—˜‚»‚¤EEE‚¾‚Æ‚ĒWindows‚ĶCygwin”Å‚¶‚į‚Č‚¢‚ĘŽg‚¦‚Č‚¢BŽc”O–³”OB
BEGIN{
@ PROCINFO["/dev/stdin", "READ_TIMEOUT"] = 180000
@ print "3•ŖŠŌ‘Ņ‚Į‚Ä‚ā‚é"
@ getline t < "/dev/stdin"
@ if (t=="ƒoƒ‹ƒX") {
@ @ print "‚ ‚ c‚ ‚ c–Ś‚Ŗ‚ ‚Ÿ‚Ÿ‚Ÿ‚Ÿ‚Ÿ`I"
@ }
@ else {
@ @ print "ŽžŠŌ‚¾I“š‚¦‚šu‚±‚¤I"
@ }
}

244 KB
V’…ƒŒƒX‚Ģ•\Ž¦

šƒXƒ}ƒz”Łš ŒfŽ¦”Ā‚É–ß‚é ‘S•” ‘O100 ŽŸ100 ÅV50
–¼‘OF E-mail (Č—Ŗ‰Ā) :


read.cgi ver 05.04.00 2017/10/04 Walang Kapalit š
FOX š DSO(Dynamic Shared Object)